Human IL26(Interleukin 26) ELISA Kit

Human Interleukin 26 (IL26) ELISA Kit

RDR-IL26-Hu-48Tests 48 Tests
EUR 458

Human Interleukin 26 (IL26) ELISA Kit

RDR-IL26-Hu-96Tests 96 Tests
EUR 633

Human Interleukin-26 (IL26)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interleukin-26(IL26) expressed in Yeast

Human Interleukin-26 (IL26)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interleukin-26 (IL26) expressed in E.coli

Human Interleukin 26 (IL26) ELISA Kit

abx574507-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human IL26/ Interleukin-26 ELISA Kit

E1284Hu 1 Kit
EUR 571

Human Interleukin- 26, IL26 ELISA KIT

ELI-05519h 96 Tests
EUR 824

Human Interleukin 26 (IL26) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 26 (IL26) ELISA Kit

abx251204-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Interleukin 26 (IL26) ELISA Kit

SEB695Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 26 (IL26) ELISA Kit

SEB695Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 26 (IL26) ELISA Kit

SEB695Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 26 (IL26) ELISA Kit

SEB695Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 26 (IL26) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 26 elisa. Alternative names of the recognized antigen: AK155
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 26 (IL26) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Interleukin 26 ELISA Kit (IL26)

RK01672 96 Tests
EUR 521

Interleukin 26 (IL26) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Interleukin 26 (IL26) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 26 (IL26) Antibody

  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 26 (IL26) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin 26 (IL26) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Interleukin 26 (IL26)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NPH9
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.5kDa
  • Isoelectric Point: 9.8
Description: Recombinant Human Interleukin 26 expressed in: E.coli

ELISA kit for Human IL26 (Interleukin 26)

ELK2152 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 26 (IL26). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin
  • Show more
Description: A sandwich ELISA kit for detection of Interleukin 26 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Interleukin 26 (IL26) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 26 (IL26)CLIA Kit

SCB695Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 26 (IL26)CLIA Kit

SCB695Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 26 (IL26)CLIA Kit

SCB695Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 26 (IL26)CLIA Kit

SCB695Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 26 (IL26) CLIA Kit

  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 26 Clia kit. Alternative names of the recognized antigen: AK155
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 26 (IL26)Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids

Human Interleukin 26 (IL26) Protein (Active)

  • EUR 1149.00
  • EUR 411.00
  • EUR 3850.00
  • EUR 1400.00
  • EUR 787.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit

MEB695Mu-10x96wellstestplate 10x96-wells test plate
EUR 5523.45
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 26 (IL26).

Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit

MEB695Mu-1x48wellstestplate 1x48-wells test plate
EUR 542.52
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 26 (IL26).

Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit

MEB695Mu-1x96wellstestplate 1x96-wells test plate
EUR 732.17
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 26 (IL26).

Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit

MEB695Mu-5x96wellstestplate 5x96-wells test plate
EUR 2994.77
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 26 (IL26) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 26 (IL26).

Mini Samples Mouse Interleukin 26 (IL26) ELISA Kit

  • EUR 5574.00
  • EUR 2945.00
  • EUR 733.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 26 elisa. Alternative names of the recognized antigen: AK155
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 26 (IL26) in samples from n/a with no significant corss-reactivity with analogues from other species.

Human IL-26(Interleukin-26) ELISA Kit

EH1888 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q9NPH9
  • Alias: IL26/Interleukin-26/IL-26/Protein AK155/AK155/interleukin 26
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Interleukin 26(IL-26)ELISA Kit

GA-E0093HM-48T 48T
EUR 289

Human Interleukin 26(IL-26)ELISA Kit

GA-E0093HM-96T 96T
EUR 466

Human Interleukin 26,IL-26 ELISA Kit

201-12-0054 96 tests
EUR 440
  • This Interleukin 26 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 26, IL-26 ELISA Kit

CSB-E11716h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 26, IL-26 in samples from serum, urine, tissue homogenates, cell lysates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 26, IL-26 ELISA Kit

  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 26, IL-26 in samples from serum, urine, tissue homogenates, cell lysates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 26(IL-26)ELISA Kit

QY-E04285 96T
EUR 361

Human Interleukin 26 ELISA kit

E01I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 26 ELISA kit

E01I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 26 ELISA kit

E01I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human IL-26 (Interleukin 26)

E-EL-H2580 1 plate of 96 wells
EUR 534
  • Gentaur's IL-26 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-26. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-26 (Interleukin 26) in samples from Serum, Plasma, Cell supernatant

IL-15, Interleukin-15, human

RC212-26 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

ELISA kit for Human Interleukin-26

EK3882 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin-26 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IL26 ELISA Kit

ELA-E1695h 96 Tests
EUR 824


EF006005 96 Tests
EUR 689

Human IL26 ELISA kit

55R-2186 96 tests
EUR 766
Description: ELISA Kit for detection of IL26 in the research laboratory

Goat Interleukin 26 ELISA kit

E06I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 26 ELISA kit

E06I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 26 ELISA kit

E06I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 26 ELISA kit

E02I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 26 ELISA kit

E02I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 26 ELISA kit

E02I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 26 ELISA kit

E03I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 26 ELISA kit

E03I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 26 ELISA kit

E03I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 26 ELISA kit

E04I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 26 ELISA kit

E04I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 26 ELISA kit

E04I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 26 ELISA kit

E08I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 26 ELISA kit

E08I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 26 ELISA kit

E08I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 26 ELISA kit

E07I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 26 ELISA kit

E07I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 26 ELISA kit

E07I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 26 ELISA kit

E09I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 26 ELISA kit

E09I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 26 ELISA kit

E09I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

IL26 ELISA Kit (Human) (OKAN05753)

OKAN05753 96 Wells
EUR 792
Description: Description of target: This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5 pg/mL

IL26 ELISA Kit (Human) (OKCD07603)

OKCD07603 96 Wells
EUR 936
Description: Description of target: This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL

IL26 ELISA Kit (Human) (OKEH01219)

OKEH01219 96 Wells
EUR 662
Description: Description of target: This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL

Guinea pig Interleukin 26 ELISA kit

E05I0017-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Interleukin 26 ELISA kit

E05I0017-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Interleukin 26 ELISA kit

E05I0017-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Interleukin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ICA (Anti-insulin cell antibody) ELISA test

26 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of ICA (Anti-insulin cell antibody)

Human IL26 Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

IL26 Chemi-Luminescent ELISA Kit (Human) (OKCD03662)

OKCD03662 96 Wells
EUR 988
Description: Description of target: May play a role in local mechanisms of mucosal immunity and seems to have a proinflammatory function. May play a role in inflammatory bowel disease. Activates STAT1 and STAT3, MAPK1/3 (ERK1/2), JUN and AKT. Induces expression of SOCS3, TNF-alpha and IL-8, secretion of IL-8 and IL-10 and surface expression of ICAM1. Decreases proliferation of intestinal epithelial cells. Is inhibited by heparin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.37 pg/mL

IL26 Antibody

ABD8983 100 ug
EUR 438

IL26 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IL26 Antibody

45630-100ul 100ul
EUR 252

IL26 Antibody

45630-50ul 50ul
EUR 187

IL26 Antibody

DF8983 200ul
EUR 304
Description: IL26 Antibody detects endogenous levels of total IL26.

IL26 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IL26. Recognizes IL26 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000


PVT17692 2 ug
EUR 258

Human Matrix Metalloproteinase 26(MMP-26)ELISA Kit

QY-E02986 96T
EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human IL26 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Connexin 26 ELISA kit

E01C0588-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Connexin 26 ELISA kit

E01C0588-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Connexin 26 ELISA kit

E01C0588-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Connexin 26 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MMP-26/ Rat MMP- 26 ELISA Kit

ELA-E1256r 96 Tests
EUR 886

IL26 Conjugated Antibody

C45630 100ul
EUR 397

IL26 Rabbit pAb

A17729-100ul 100 ul
EUR 308

IL26 Rabbit pAb

A17729-200ul 200 ul
EUR 459

IL26 Rabbit pAb

A17729-20ul 20 ul
EUR 183

IL26 Rabbit pAb

A17729-50ul 50 ul
EUR 223

IL26 cloning plasmid

CSB-CL873613HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 516
  • Sequence: atgctggtgaatttcattttgaggtgtgggttgctgttagtcactctgtctcttgccattgccaagcacaagcaatcttccttcaccaaaagttgttacccaaggggaacattgtcccaagctgttgacgctctctatatcaaagcagcatggctcaaagcaacgattccagaaga
  • Show more
Description: A cloning plasmid for the IL26 gene.

IL26 cloning plasmid

CSB-CL873613HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 516
  • Sequence: atgctggtgaatttcattttgaggtgtgggttgctgttagtcactctgtctcttgccattgccaagcacaagcaatcttccttcaccaaaagttgttacccaaggggaacattgtcccaagctgttgacgctctctatatcaaagcagcatggctcaaagcaacgattccagaaga
  • Show more
Description: A cloning plasmid for the IL26 gene.

IL26 Blocking Peptide

DF8983-BP 1mg
EUR 195

pET3a-IL26 Plasmid

PVTB00087-1d 2 ug
EUR 356

Anti-IL26 antibody

STJ119771 100 µl
EUR 277
Description: This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri. [provided by RefSeq, Jul 2008]

Anti-IL26 (2A8)

YF-MA18835 100 ug
EUR 363
Description: Mouse monoclonal to IL26

Human IL26(Interleukin 26) ELISA Kit