Human KRT13(Keratin 13) ELISA Kit
Human Keratin 13 (KRT13) ELISA Kit |
RD-KRT13-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Keratin 13 (KRT13) ELISA Kit |
20-abx152106 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Keratin 13 (KRT13) ELISA Kit |
abx252200-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Keratin 13 (KRT13) ELISA Kit |
abx574530-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Keratin 13 (KRT13) ELISA Kit |
SEB875Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids. |
Human Keratin 13 (KRT13) ELISA Kit |
SEB875Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids. |
Human Keratin 13 (KRT13) ELISA Kit |
SEB875Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids. |
Human Keratin 13 (KRT13) ELISA Kit |
SEB875Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 13 (KRT13) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 13 (KRT13) in serum, plasma, tissue homogenates and other biological fluids. |
Human Keratin 13 (KRT13) ELISA Kit |
4-SEB875Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Keratin 13 elisa. Alternative names of the recognized antigen: CK13
- Cytokeratin 13
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 13 (KRT13) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Monkey Keratin 13 (KRT13) ELISA Kit |
abx359862-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Keratin 13 (KRT13) ELISA Kit |
abx361624-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Keratin 13 (KRT13) ELISA Kit |
abx362517-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Keratin 13 (KRT13) ELISA Kit |
abx356204-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Keratin 13 (Krt13) ELISA Kit |
abx518685-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Keratin 13 (Krt13) ELISA Kit |
abx518686-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Keratin 13 (KRT13) Antibody |
20-abx007043 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody |
20-abx113335 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody |
20-abx128817 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Keratin 13 (KRT13) Antibody |
20-abx130295 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Keratin 13 (KRT13) Antibody |
abx145863-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody |
20-abx173243 |
Abbexa |
|
|
|
Keratin 13 (KRT13) Antibody |
abx011779-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody |
abx032946-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody |
abx032946-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody |
20-abx241469 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody |
20-abx241748 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody |
20-abx329125 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody |
abx432902-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Keratin 13 (KRT13) Antibody |
20-abx301829 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Keratin 13 (KRT13) |
4-RPB875Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P13646
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 38.7kDa
- Isoelectric Point: 5
|
Description: Recombinant Human Keratin 13 expressed in: E.coli |
Recombinant Keratin 13 (KRT13) |
4-RPB875Ra01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q6IFV4
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.8kDa
- Isoelectric Point: 5.5
|
Description: Recombinant Rat Keratin 13 expressed in: E.coli |
ELISA kit for Human KRT13 (Keratin 13) |
ELK2239 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 13 (KRT13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 13 (KRT
- Show more
|
Description: A sandwich ELISA kit for detection of Keratin 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Keratin 13 (KRT13) CLIA Kit |
20-abx493201 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Keratin 13 (KRT13) Protein |
20-abx166967 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Keratin 13 (KRT13) Protein |
20-abx167695 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Keratin 13 (KRT13) Antibody (HRP) |
20-abx315816 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody (FITC) |
20-abx315817 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) Antibody (Biotin) |
20-abx315818 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Keratin 13 (KRT13) polyclonal antibody |
ABP-PAB-02125 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Human Keratin, type I cytoskeletal 13, KRT13 ELISA KIT |
ELI-06022h |
Lifescience Market |
96 Tests |
EUR 824 |
Keratin 13 (KRT13) Polyclonal Antibody (Rat) |
4-PAB875Ra01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Leu266~Gln404)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13) |
Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig) |
4-PAB875Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Glu104~Ala403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13) |
Mouse Keratin, type I cytoskeletal 13, Krt13 ELISA KIT |
ELI-06021m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Human Keratin, type I cytoskeletal 13 (KRT13) |
KTE61885-48T |
Abbkine |
48T |
EUR 332 |
- Keratin 13 is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins co
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 13 (KRT13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Keratin, type I cytoskeletal 13 (KRT13) |
KTE61885-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Keratin 13 is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins co
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 13 (KRT13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Keratin, type I cytoskeletal 13 (KRT13) |
KTE61885-96T |
Abbkine |
96T |
EUR 539 |
- Keratin 13 is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins co
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 13 (KRT13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Keratin 13 (KRT13) Polyclonal Antibody (Rat), APC |
4-PAB875Ra01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Leu266~Gln404)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with APC. |
Keratin 13 (KRT13) Polyclonal Antibody (Rat), Biotinylated |
4-PAB875Ra01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Leu266~Gln404)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with Biotin. |
Keratin 13 (KRT13) Polyclonal Antibody (Rat), Cy3 |
4-PAB875Ra01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Leu266~Gln404)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with Cy3. |
Keratin 13 (KRT13) Polyclonal Antibody (Rat), FITC |
4-PAB875Ra01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Leu266~Gln404)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with FITC. |
Keratin 13 (KRT13) Polyclonal Antibody (Rat), HRP |
4-PAB875Ra01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Leu266~Gln404)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with HRP. |
Keratin 13 (KRT13) Polyclonal Antibody (Rat), PE |
4-PAB875Ra01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Leu266~Gln404)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with PE. |
Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), APC |
4-PAB875Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Glu104~Ala403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with APC. |
Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAB875Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Glu104~Ala403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with Biotin. |
Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAB875Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Glu104~Ala403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with Cy3. |
Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), FITC |
4-PAB875Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Glu104~Ala403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with FITC. |
Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), HRP |
4-PAB875Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Glu104~Ala403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with HRP. |
Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), PE |
4-PAB875Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Glu104~Ala403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with PE. |
Human CK-13/KRT13(Cytokeratin 13) ELISA Kit |
EH2818 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 15.625-1000 pg/ml
- Uniprot ID: P13646
- Alias: CK-13/KRT13/Cytokeratin-13/CK-13/Keratin-13/K13/Keratin, type I cytoskeletal 13
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Keratin 13 (KRT13) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAB875Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Glu104~Ala403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Keratin 13 (KRT13). This antibody is labeled with APC-Cy7. |
Keratin 13 (KRT13) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAB875Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KRT13 (Leu266~Gln404)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Keratin 13 (KRT13). This antibody is labeled with APC-Cy7. |
ELISA kit for Human CK-13/KRT13 (Cytokeratin 13) |
E-EL-H2070 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's CK-13/KRT13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CK-13/KRT13. Standards or samples are added to the micro ELISA plate wells and co
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human CK-13/KRT13 (Cytokeratin 13) in samples from Serum, Plasma, Cell supernatant |
Human Cytokeratin 13 / CK-13 (KRT13) CLIA Kit |
abx196587-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Cytokeratin 13 (KRT13) Antibody |
20-abx009057 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Cytokeratin 13 (KRT13) Antibody |
abx232193-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
CLIA kit for Human CK-13/KRT13 (Cytokeratin 13) |
E-CL-H1242 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's CK-13/KRT13 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CK-13/KRT13 . Standards or samples are added to the micro CLIA plate wells and comb
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human CK-13/KRT13 (Cytokeratin 13) in samples from Serum, Plasma, Cell supernatant |
99445-13 DCT 13 X 100MM |
99445-13 |
CORNING |
250/pk |
EUR 76 |
Description: Disposable Culture Tubes; DCT's, CGW |
99999 CAP 13-415 |
99999-13 |
CORNING |
1000/pk |
EUR 219 |
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Caps |
9998 SCREW CAP 415/13 |
9998-13 |
CORNING |
288/pk |
EUR 198 |
Description: General Apparatus; Stoppers |
99447 DSSCT 13 X 100MM W/ MARING SPOT |
99447-13 |
CORNING |
250/pk |
EUR 332 |
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock |
99449 DSSCT 13 X 100MM W/O MARKING SPOT |
99449-13 |
CORNING |
250/pk |
EUR 281 |
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock |
Human Keratin- associated protein 13- 4, KRTAP13-4 ELISA KIT |
ELI-14113h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Keratin- associated protein 13- 1, KRTAP13-1 ELISA KIT |
ELI-19294h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Keratin- associated protein 13- 3, KRTAP13-3 ELISA KIT |
ELI-28023h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Keratin- associated protein 13- 2, KRTAP13-2 ELISA KIT |
ELI-43316h |
Lifescience Market |
96 Tests |
EUR 824 |
Polyclonal KRT13 / CK13 / Cytokeratin 13 Antibody (C-Terminus) |
APG01061G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human KRT13 / CK13 / Cytokeratin 13 (C-Terminus). This antibody is tested and proven to work in the following applications: |
CA199 (Cancer antigen) ELISA test |
13 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen) |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
KRT13 antibody |
70R-18179 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal KRT13 antibody |
KRT13 Antibody |
35558-100ul |
SAB |
100ul |
EUR 252 |
KRT13 Antibody |
1-CSB-PA002017 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000 |
KRT13 Antibody |
1-CSB-PA441632 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:5-1:20 |
KRT13 Antibody |
1-CSB-PA297945 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:5-1:20 |
KRT13 Antibody |
BF0051 |
Affbiotech |
200ul |
EUR 376 |
Description: KRT13 antibody detects endogenous levels of total KRT13. |
KRT13 Antibody |
1-CSB-PA012511GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
KRT13 Antibody |
1-CSB-PA012511LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KRT13. Recognizes KRT13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
KRT13 siRNA |
20-abx902891 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KRT13 siRNA |
20-abx921947 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KRT13 siRNA |
20-abx921948 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal KRT13 / CK13 / Cytokeratin 13 Antibody (clone AE8), Clone: AE8 |
AMM01786G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human KRT13 / CK13 / Cytokeratin 13 (clone AE8). The antibodies are raised in Mouse and are from clone AE8. This antibody is applicable in WB and IHC-P |
Human KRT13 shRNA Plasmid |
20-abx952620 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KRT13 Recombinant Protein (Human) |
RP040483 |
ABM |
100 ug |
Ask for price |
Human Interleukin 13,IL-13 ELISA KIT |
201-12-0099 |
SunredBio |
96 tests |
EUR 440 |
- This Interleukin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human cytokeratin 13,CK-13 ELISA Kit |
201-12-1608 |
SunredBio |
96 tests |
EUR 440 |
- This cytokeratin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Interleukin 13, IL-13 ELISA KIT |
CSB-E04601h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Interleukin 13, IL-13 ELISA KIT |
1-CSB-E04601h |
Cusabio |
-
EUR 603.00
-
EUR 4247.00
-
EUR 2260.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human IL-13(Interleukin 13) ELISA Kit |
EH3266 |
FN Test |
96T |
EUR 476.25 |
- Detection range: 15.625-1000 pg/ml
- Uniprot ID: P35225
- Alias: IL-13(Interleukin 13)/BHR1interleukin-13
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Human Interleukin 13,IL-13 ELISA KIT |
CN-03217H1 |
ChemNorm |
96T |
EUR 434 |
Human Interleukin 13,IL-13 ELISA KIT |
CN-03217H2 |
ChemNorm |
48T |
EUR 284 |
Human cytokeratin 13(CK-13)ELISA Kit |
GA-E1624HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human cytokeratin 13(CK-13)ELISA Kit |
GA-E1624HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Interleukin 13(IL-13)ELISA Kit |
GA-E0138HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Interleukin 13(IL-13)ELISA Kit |
GA-E0138HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Interleukin-13 (IL-13) ELISA Kit |
LF-EK60050 |
Abfrontier |
1×96T |
EUR 790 |
Human Matrix metalloproteinase 13,MMP-13 ELISA kit |
201-12-0912 |
SunredBio |
96 tests |
EUR 440 |
- This Matrix metalloproteinase 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
ELISA kit for Human IL-13 (Interleukin 13) |
E-EL-H0104 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's IL-13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-13. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human IL-13 (Interleukin 13) in samples from Serum, Plasma, Cell supernatant |
Human Matrix metalloproteinase 13, MMP-13 ELISA kit |
CSB-E04674h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Matrix metalloproteinase 13, MMP-13 ELISA kit |
1-CSB-E04674h |
Cusabio |
-
EUR 723.00
-
EUR 4883.00
-
EUR 2591.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Matrix metalloproteinase 13,MMP-13 ELISA kit |
CN-03225H1 |
ChemNorm |
96T |
EUR 448 |
Human Matrix metalloproteinase 13,MMP-13 ELISA kit |
CN-03225H2 |
ChemNorm |
48T |
EUR 297 |
Human Matrix metalloproteinase 13(MMP-13)ELISA Kit |
GA-E0928HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Matrix metalloproteinase 13(MMP-13)ELISA Kit |
GA-E0928HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
KRT13 Conjugated Antibody |
C35558 |
SAB |
100ul |
EUR 397 |
KRT13 Blocking Peptide |
BF0051-BP |
Affbiotech |
1mg |
EUR 195 |
KRT13 cloning plasmid |
CSB-CL012511HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1377
- Sequence: atgagcctccgcctgcagagctcctctgccagctatggaggtggtttcgggggtggctcttgccagctgggaggaggccgtggtgtctctacctgttcaactcggtttgtgtctgggggatcagctgggggctatggaggcggcgtgagctgtggttttggtggaggggctggta
- Show more
|
Description: A cloning plasmid for the KRT13 gene. |
KRT13 Rabbit pAb |
A7697-100ul |
Abclonal |
100 ul |
EUR 308 |
KRT13 Rabbit pAb |
A7697-200ul |
Abclonal |
200 ul |
EUR 459 |
KRT13 Rabbit pAb |
A7697-20ul |
Abclonal |
20 ul |
EUR 183 |
KRT13 Rabbit pAb |
A7697-50ul |
Abclonal |
50 ul |
EUR 223 |
KRT13 Rabbit pAb |
A16393-100ul |
Abclonal |
100 ul |
EUR 308 |
KRT13 Rabbit pAb |
A16393-200ul |
Abclonal |
200 ul |
EUR 459 |
KRT13 Rabbit pAb |
A16393-20ul |
Abclonal |
20 ul |
EUR 183 |
KRT13 Rabbit pAb |
A16393-50ul |
Abclonal |
50 ul |
EUR 223 |
anti-KRT13 (3G4) |
LF-MA30754 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to KRT13 |
Anti-KRT13 antibody |
STJ110010 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Mutations in this gene and keratin 4 have been associated with the autosomal dominant disorder White Sponge Nevus. The type I cytokeratins are clustered in a region of chromosome 17q21.2. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been described. |
KRT13 ORF Vector (Human) (pORF) |
ORF013495 |
ABM |
1.0 ug DNA |
EUR 354 |
Human IL-13 ELISA kit |
CT208A |
U-CyTech |
5-plate |
EUR 462 |
Human CytoKeratin 13 ELISA kit |
E01C0759-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CytoKeratin 13 ELISA kit |
E01C0759-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CytoKeratin 13 ELISA kit |
E01C0759-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human CytoKeratin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apelin 13 ELISA kit |
E01A0036-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apelin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apelin 13 ELISA kit |
E01A0036-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apelin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interleukin 13 ELISA kit |
E01I0036-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interleukin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interleukin 13 ELISA kit |
E01I0036-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interleukin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interleukin 13 ELISA kit |
E01I0036-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interleukin 13 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apelin -13 ELISA Kit |
EHA0043 |
Abclonal |
96Tests |
EUR 521 |
Human CK 13 ELISA Kit |
EHC0766 |
Abclonal |
96Tests |
EUR 521 |
Human IL-13 ELISA Kit |
EHI0043 |
Abclonal |
96Tests |
EUR 521 |
Human MMP-13 ELISA Kit |
EHM0309 |
Abclonal |
96Tests |
EUR 521 |
IL-13 (Human) ELISA Kit |
E4284-100 |
Biovision |
|
EUR 729 |
Human IL-13 ELISA Kit |
LF-EK50832 |
Abfrontier |
1×96T |
EUR 648 |
Human IL-13 ELISA Kit |
RK00034 |
Abclonal |
96 Tests |
EUR 521 |
Keratin-Associated Protein 13-3 (KRTAP13-3) Antibody |
abx026808-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Keratin-Associated Protein 13-3 (KRTAP13-3) Antibody |
abx026808-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Keratin-Associated Protein 13-1 (KRTAP13-1) Antibody |
20-abx308624 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Keratin-Associated Protein 13-3 (KRTAP13-3) Antibody |
20-abx307237 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Keratin-Associated Protein 13-4 (KRTAP13-4) Antibody |
20-abx307241 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Human epidermal keratin,EK ELISA Kit |
201-12-1624 |
SunredBio |
96 tests |
EUR 440 |
- This epidermal keratin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Keratin 2(KRT2)ELISA Kit |
201-12-3211 |
SunredBio |
96 tests |
EUR 440 |
- This Keratin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Keratin 1 (KRT1) ELISA Kit |
DLR-KRT1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Keratin 1 (KRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 1 (KRT1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Keratin 1 (KRT1) ELISA Kit |
DLR-KRT1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Keratin 1 (KRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 1 (KRT1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Keratin 10 (KRT10) ELISA Kit |
DLR-KRT10-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Keratin 10 (KRT10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 10 (KRT10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Keratin 10 (KRT10) ELISA Kit |
DLR-KRT10-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Keratin 10 (KRT10) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 10 (KRT10) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Keratin 14 (KRT14) ELISA Kit |
DLR-KRT14-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Keratin 14 (KRT14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 14 (KRT14) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Keratin 14 (KRT14) ELISA Kit |
DLR-KRT14-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Keratin 14 (KRT14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 14 (KRT14) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Keratin 16 (KRT16) ELISA Kit |
DLR-KRT16-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Keratin 16 (KRT16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 16 (KRT16) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Keratin 16 (KRT16) ELISA Kit |
DLR-KRT16-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Keratin 16 (KRT16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 16 (KRT16) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Keratin 17 (KRT17) ELISA Kit |
DLR-KRT17-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Keratin 17 (KRT17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 17 (KRT17) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Keratin 17 (KRT17) ELISA Kit |
DLR-KRT17-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Keratin 17 (KRT17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 17 (KRT17) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Keratin 18 (KRT18) ELISA Kit |
DLR-KRT18-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Keratin 18 (KRT18) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 18 (KRT18) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Keratin 18 (KRT18) ELISA Kit |
DLR-KRT18-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Keratin 18 (KRT18) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 18 (KRT18) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Keratin 19 (KRT19) ELISA Kit |
DLR-KRT19-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Keratin 19 (KRT19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 19 (KRT19) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Keratin 19 (KRT19) ELISA Kit |
DLR-KRT19-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Keratin 19 (KRT19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 19 (KRT19) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Keratin 2 (KRT2) ELISA Kit |
DLR-KRT2-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Keratin 2 (KRT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 2 (KRT2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Keratin 2 (KRT2) ELISA Kit |
DLR-KRT2-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Keratin 2 (KRT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 2 (KRT2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Keratin 20 (KRT20) ELISA Kit |
DLR-KRT20-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Keratin 20 (KRT20) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 20 (KRT20) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Keratin 20 (KRT20) ELISA Kit |
DLR-KRT20-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Keratin 20 (KRT20) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Keratin 20 (KRT20) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human KRT13(Keratin 13) ELISA Kit