Human MUC7(Mucin 7, Secreted) ELISA Kit

Human Mucin 7, Secreted (MUC7) ELISA Kit

RD-MUC7-Hu-96Tests 96 Tests
EUR 692

Human Mucin-7, Secreted (MUC7) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mucin-7, Secreted (MUC7) ELISA Kit

abx251263-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Mucin-7, Secreted (MUC7) ELISA Kit

abx572156-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Mucin 7, Secreted ELISA Kit (MUC7)

RK01900 96 Tests
EUR 521

Human Mucin 7, Secreted (MUC7) ELISA Kit

SEB808Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

SEB808Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

SEB808Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

SEB808Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids.

Human Mucin 7, Secreted (MUC7) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Mucin 7, Secreted elisa. Alternative names of the recognized antigen: MG2
  • Mucin 7, Salivary
  • Apo-MG2
  • Salivary mucin-7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mucin 7, Secreted (MUC7) Antibody

  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mucin 7, Secreted (MUC7) Antibody

  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mucin 7, Secreted (MUC7) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Mucin 7, Secreted (MUC7)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 66.8kDa
  • Isoelectric Point: 8.2
Description: Recombinant Human Recombinant Mucin 7, Secreted (MUC7) expressed in: E.coli

Pig Mucin-7, Secreted (MUC7) ELISA Kit

abx361133-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Mucin-7, Secreted (MUC7) ELISA Kit

abx363009-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Mucin-7, Secreted (MUC7) ELISA Kit

abx350994-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Chicken Mucin-7, Secreted (MUC7) ELISA Kit

abx355984-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Mucin-7, Secreted (MUC7) ELISA Kit

abx359170-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Mucin 7, Secreted (MUC7) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Mucin-7, Secreted (MUC7) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human MUC7 (Mucin 7, Secreted)

ELK2203 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mucin 7, Secreted (MUC7). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mucin 7,
  • Show more
Description: A sandwich ELISA kit for detection of Mucin 7, Secreted from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Mucin-7, Secreted (MUC7) ELISA Kit

abx357346-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Mucin-7,MUC7 ELISA Kit

201-12-1614 96 tests
EUR 440
  • This Mucin-7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human MUC7/ Mucin-7 ELISA Kit

E1675Hu 1 Kit
EUR 571

Human MUC7(Mucin-7) ELISA Kit

EH1942 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q8TAX7
  • Alias: MUC7/MG2/MUC-7/Apo-MG2/Salivary mucin-7
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Mucin- 7, MUC7 ELISA KIT

ELI-05843h 96 Tests
EUR 824

Human Mucin-7, MUC7 ELISA Kit

CSB-E11853h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-7, MUC7 ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin-7(MUC7)ELISA Kit

GA-E1630HM-48T 48T
EUR 289

Human Mucin-7(MUC7)ELISA Kit

GA-E1630HM-96T 96T
EUR 466

Human Mucin-7(MUC7)ELISA Kit

QY-E00294 96T
EUR 361

Mucin 7 (MUC7) Antibody

abx216981-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Mucin 7 (MUC7) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mucin 7 (MUC7) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Human MUC7 (Mucin 7)

E-EL-H2281 1 plate of 96 wells
EUR 534
  • Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Mucin-7 (MUC7)

KTE61449-48T 48T
EUR 354
  • MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-7 (MUC7)

KTE61449-5platesof96wells 5 plates of 96 wells
EUR 2252
  • MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-7 (MUC7)

KTE61449-96T 96T
EUR 572
  • MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Mucin 7 (MUC7) CLIA Kit

abx197312-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Mouse MUC7 (Mucin-7)

E-EL-M0801 1 plate of 96 wells
EUR 534
  • Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse MUC7 (Mucin-7) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse Mucin-7 (MUC7)

KTE71571-48T 48T
EUR 332
  • The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mucin-7 (MUC7)

KTE71571-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Mucin-7 (MUC7)

KTE71571-96T 96T
EUR 539
  • The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Mucin-7(MUC7)ELISA Ki      

GA-E0485MS-48T 48T
EUR 336

Mouse Mucin-7(MUC7)ELISA Ki      

GA-E0485MS-96T 96T
EUR 534

CLIA kit for Human MUC7 (Mucin 7)

E-CL-H1342 1 plate of 96 wells
EUR 584
  • Gentaur's MUC7 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant

Human Mucin 7 ELISA kit

E01M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit

E01M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit

E01M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MUC7 ELISA Kit

ELA-E1808h 96 Tests
EUR 824

Human MUC7 ELISA Kit

EHM0361 96Tests
EUR 521


EF006051 96 Tests
EUR 689

ELISA kit for Human Mucin-7

EK3979 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-7 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Mucin 7 ELISA kit

E02M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mucin 7 ELISA kit

E02M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mucin 7 ELISA kit

E02M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mucin 7 ELISA kit

E04M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mucin 7 ELISA kit

E04M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mucin 7 ELISA kit

E04M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mucin 7 ELISA kit

E03M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mucin 7 ELISA kit

E03M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mucin 7 ELISA kit

E03M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mucin 7 ELISA kit

E06M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mucin 7 ELISA kit

E06M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mucin 7 ELISA kit

E06M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mucin 7 ELISA kit

E08M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mucin 7 ELISA kit

E08M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mucin 7 ELISA kit

E08M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mucin 7 ELISA kit

E07M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mucin 7 ELISA kit

E07M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mucin 7 ELISA kit

E07M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mucin 7 ELISA kit

E09M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mucin 7 ELISA kit

E09M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mucin 7 ELISA kit

E09M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine MUC7 ELISA Kit

EBM0361 96Tests
EUR 521

Anserini MUC7 ELISA Kit

EAM0361 96Tests
EUR 521

Chicken MUC7 ELISA Kit

ECKM0361 96Tests
EUR 521

Canine MUC7 ELISA Kit

ECM0361 96Tests
EUR 521


EGTM0361 96Tests
EUR 521

Porcine MUC7 ELISA Kit

EPM0361 96Tests
EUR 521

Sheep MUC7 ELISA Kit

ESM0361 96Tests
EUR 521


ERM0361 96Tests
EUR 521

Rabbit MUC7 ELISA Kit

ERTM0361 96Tests
EUR 521

Monkey MUC7 ELISA Kit

EMKM0361 96Tests
EUR 521

Mouse MUC7 ELISA Kit

EMM0361 96Tests
EUR 521

Guinea pig Mucin 7 ELISA kit

E05M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mucin 7 ELISA kit

E05M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mucin 7 ELISA kit

E05M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea Pig MUC7 ELISA Kit

EGM0361 96Tests
EUR 521

Recombinant Human Secreted Phospholipase A2-X

7-03355 2µg Ask for price

Recombinant Human Secreted Phospholipase A2-X

7-03356 10µg Ask for price

Recombinant Human Secreted Phospholipase A2-X

7-03357 1mg Ask for price

Recombinant Human Secreted Phospholipase A2-XII

7-03358 2µg Ask for price

Recombinant Human Secreted Phospholipase A2-XII

7-03359 10µg Ask for price

Recombinant Human Secreted Phospholipase A2-XII

7-03360 1mg Ask for price

Recombinant Human Secreted Phospholipase A2-IB

7-03361 2µg Ask for price

Recombinant Human Secreted Phospholipase A2-IB

7-03362 10µg Ask for price

Recombinant Human Secreted Phospholipase A2-IB

7-03363 1mg Ask for price

Recombinant Human Secreted Phospholipase A2-IIA

7-03364 2µg Ask for price

Recombinant Human Secreted Phospholipase A2-IIA

7-03365 10µg Ask for price

Recombinant Human Secreted Phospholipase A2-IIA

7-03366 1mg Ask for price

Recombinant Human Secreted Phospholipase A2-IID

7-03367 2µg Ask for price

Recombinant Human Secreted Phospholipase A2-IID

7-03368 10µg Ask for price

Recombinant Human Secreted Phospholipase A2-IID

7-03369 1mg Ask for price

Recombinant Human Secreted Phospholipase A2-IIE

7-03370 2µg Ask for price

Recombinant Human Secreted Phospholipase A2-IIE

7-03371 10µg Ask for price

Recombinant Human Secreted Phospholipase A2-IIE

7-03372 1mg Ask for price

Recombinant Human Secreted Phospholipase A2-V

7-03373 2µg Ask for price

Recombinant Human Secreted Phospholipase A2-V

7-03374 10µg Ask for price

Recombinant Human Secreted Phospholipase A2-V

7-03375 1mg Ask for price

Recombinant Human Secreted Phospholipase A2-VII

7-03376 2µg Ask for price

Recombinant Human Secreted Phospholipase A2-VII

7-03377 10µg Ask for price

Recombinant Human Secreted Phospholipase A2-VII

7-03378 1mg Ask for price

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Hu-48T 48T
EUR 501
  • Should the Human Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Hu-96T 96T
EUR 651
  • Should the Human Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Hu-48Tests 48 Tests
EUR 503

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Hu-96Tests 96 Tests
EUR 697

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-Hu-48Tests 48 Tests
EUR 525

Human Angiotensin 1-7 (Ang1-7) ELISA Kit

RDR-Ang1-7-Hu-96Tests 96 Tests
EUR 729

MUC7 Antibody

43220-100ul 100ul
EUR 252

MUC7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

MUC7 Antibody

DF9642 200ul
EUR 304
Description: MUC7 Antibody detects endogenous levels of total MUC7.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MUC7 Antibody

ABD9642 100 ug
EUR 438


YF-PA24185 50 ul
EUR 334
Description: Mouse polyclonal to MUC7

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human MUC7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MUC7 Recombinant Protein (Human)

RP020392 100 ug Ask for price

Recombinant Human Secreted Protein Acidic & Rich in Cysteine

7-06505 10µg Ask for price

Recombinant Human Secreted Protein Acidic & Rich in Cysteine

7-06506 50µg Ask for price

Recombinant Human Secreted Protein Acidic & Rich in Cysteine

7-06507 1mg Ask for price

Anti-MUC7 Antibody

A05210 100ug/vial
EUR 294

MUC7 Blocking Peptide

DF9642-BP 1mg
EUR 195

MUC7 Conjugated Antibody

C43220 100ul
EUR 397

MUC7 cloning plasmid

CSB-CL851529HU-10ug 10ug
EUR 427
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgaaaactctgccgctgtttgtgtgcatctgtgcactgagtgcttgcttctcgttcagtgaaggtcgagaaagggatcatgaactacgtcacagaaggcatcatcaccaatcacccaaatctcactttgaattaccacattatcctggactgctagctcaccagaagccgttca
  • Show more
Description: A cloning plasmid for the MUC7 gene.

MUC7 Polyclonal Antibody

ABP59345-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120

MUC7 Polyclonal Antibody

ABP59345-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120

MUC7 Polyclonal Antibody

ABP59345-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120

MUC7 Polyclonal Antibody

ES9828-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MUC7 Polyclonal Antibody

ES9828-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MUC7 antibody

STJ190986 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MUC7

Anti-MUC7 (7F2)

YF-MA10594 100 ug
EUR 363
Description: Mouse monoclonal to MUC7

Anti-MUC7 (1C10)

YF-MA14331 100 ug
EUR 363
Description: Mouse monoclonal to MUC7

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-c-48T 48T
EUR 560
  • Should the Canine Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-c-96T 96T
EUR 732
  • Should the Canine Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Mu-48T 48T
EUR 512
  • Should the Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Mu-96T 96T
EUR 667
  • Should the Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Ra-48T 48T
EUR 536
  • Should the Rat Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit

DLR-Ang1-7-Ra-96T 96T
EUR 700
  • Should the Rat Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-c-48Tests 48 Tests
EUR 569

Canine Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-c-96Tests 96 Tests
EUR 792

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Mu-48Tests 48 Tests
EUR 516

Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Mu-96Tests 96 Tests
EUR 716

Rat Angiotensin 1-7 (Ang1-7) ELISA Kit

RD-Ang1-7-Ra-48Tests 48 Tests
EUR 543

Human MUC7(Mucin 7, Secreted) ELISA Kit