Human MUC7(Mucin 7, Secreted) ELISA Kit
Human Mucin 7, Secreted (MUC7) ELISA Kit |
RD-MUC7-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Mucin-7, Secreted (MUC7) ELISA Kit |
20-abx152403 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Mucin-7, Secreted (MUC7) ELISA Kit |
abx251263-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Mucin-7, Secreted (MUC7) ELISA Kit |
abx572156-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Mucin 7, Secreted ELISA Kit (MUC7) |
RK01900 |
Abclonal |
96 Tests |
EUR 521 |
Human Mucin 7, Secreted (MUC7) ELISA Kit |
SEB808Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids. |
Human Mucin 7, Secreted (MUC7) ELISA Kit |
SEB808Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids. |
Human Mucin 7, Secreted (MUC7) ELISA Kit |
SEB808Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids. |
Human Mucin 7, Secreted (MUC7) ELISA Kit |
SEB808Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 7, Secreted (MUC7) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 7, Secreted (MUC7) in serum, plasma, saliva, tissue homogenates and other biological fluids. |
Human Mucin 7, Secreted (MUC7) ELISA Kit |
4-SEB808Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Mucin 7, Secreted elisa. Alternative names of the recognized antigen: MG2
- Mucin 7, Salivary
- Apo-MG2
- Salivary mucin-7
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mucin 7, Secreted (MUC7) Antibody |
20-abx177629 |
Abbexa |
|
|
|
Mucin 7, Secreted (MUC7) Antibody |
20-abx177630 |
Abbexa |
|
|
|
Mucin 7, Secreted (MUC7) Antibody |
20-abx173632 |
Abbexa |
|
|
|
Recombinant Mucin 7, Secreted (MUC7) |
4-RPB808Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 66.8kDa
- Isoelectric Point: 8.2
|
Description: Recombinant Human Recombinant Mucin 7, Secreted (MUC7) expressed in: E.coli |
Pig Mucin-7, Secreted (MUC7) ELISA Kit |
abx361133-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Mucin-7, Secreted (MUC7) ELISA Kit |
abx363009-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Mucin-7, Secreted (MUC7) ELISA Kit |
abx350994-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Chicken Mucin-7, Secreted (MUC7) ELISA Kit |
abx355984-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Mucin-7, Secreted (MUC7) ELISA Kit |
abx359170-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Mucin 7, Secreted (MUC7) Protein |
20-abx654412 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Mucin-7, Secreted (MUC7) CLIA Kit |
20-abx493103 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human MUC7 (Mucin 7, Secreted) |
ELK2203 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mucin 7, Secreted (MUC7). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mucin 7,
- Show more
|
Description: A sandwich ELISA kit for detection of Mucin 7, Secreted from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig Mucin-7, Secreted (MUC7) ELISA Kit |
abx357346-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Mucin-7,MUC7 ELISA Kit |
201-12-1614 |
SunredBio |
96 tests |
EUR 440 |
- This Mucin-7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human MUC7/ Mucin-7 ELISA Kit |
E1675Hu |
Sunlong |
1 Kit |
EUR 571 |
Human MUC7(Mucin-7) ELISA Kit |
EH1942 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: Q8TAX7
- Alias: MUC7/MG2/MUC-7/Apo-MG2/Salivary mucin-7
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Mucin-7, MUC7 ELISA Kit |
CSB-E11853h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Mucin-7, MUC7 ELISA Kit |
1-CSB-E11853h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-7, MUC7 in samples from serum, plasma, cell culture supernates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mucin 7 (MUC7) Antibody |
abx216981-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Mucin 7 (MUC7) Antibody |
20-abx210446 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mucin 7 (MUC7) Antibody |
20-abx210681 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Human MUC7 (Mucin 7) |
E-EL-H2281 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human Mucin-7 (MUC7) |
KTE61449-48T |
Abbkine |
48T |
EUR 354 |
- MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mucin-7 (MUC7) |
KTE61449-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Mucin-7 (MUC7) |
KTE61449-96T |
Abbkine |
96T |
EUR 572 |
- MUC7 encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Mucin 7 (MUC7) CLIA Kit |
abx197312-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse MUC7 (Mucin-7) |
E-EL-M0801 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's MUC7 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse MUC7. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse MUC7 (Mucin-7) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Mouse Mucin-7 (MUC7) |
KTE71571-48T |
Abbkine |
48T |
EUR 332 |
- The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Mucin-7 (MUC7) |
KTE71571-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Mucin-7 (MUC7) |
KTE71571-96T |
Abbkine |
96T |
EUR 539 |
- The MUC7 gene encodes a small salivary mucin, which is thought to function in a protective capacity by promoting the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing.Bobek et al. (1996) found that the MUC7 ge
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Mucin-7 (MUC7) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
CLIA kit for Human MUC7 (Mucin 7) |
E-CL-H1342 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's MUC7 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MUC7 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human MUC7 (Mucin 7) in samples from Serum, Plasma, Cell supernatant |
Human Mucin 7 ELISA kit |
E01M0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Mucin 7 ELISA kit |
E01M0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Mucin 7 ELISA kit |
E01M0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human MUC7 ELISA Kit |
EHM0361 |
Abclonal |
96Tests |
EUR 521 |
ELISA kit for Human Mucin-7 |
EK3979 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-7 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Rat Mucin 7 ELISA kit |
E02M0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Mucin 7 ELISA kit |
E02M0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Mucin 7 ELISA kit |
E02M0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mucin 7 ELISA kit |
E04M0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mucin 7 ELISA kit |
E04M0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mucin 7 ELISA kit |
E04M0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mucin 7 ELISA kit |
E03M0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mucin 7 ELISA kit |
E03M0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mucin 7 ELISA kit |
E03M0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Mucin 7 ELISA kit |
E06M0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Mucin 7 ELISA kit |
E06M0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Mucin 7 ELISA kit |
E06M0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Mucin 7 ELISA kit |
E08M0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Mucin 7 ELISA kit |
E08M0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Mucin 7 ELISA kit |
E08M0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Mucin 7 ELISA kit |
E07M0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Mucin 7 ELISA kit |
E07M0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Mucin 7 ELISA kit |
E07M0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Mucin 7 ELISA kit |
E09M0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Mucin 7 ELISA kit |
E09M0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Mucin 7 ELISA kit |
E09M0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Bovine MUC7 ELISA Kit |
EBM0361 |
Abclonal |
96Tests |
EUR 521 |
Anserini MUC7 ELISA Kit |
EAM0361 |
Abclonal |
96Tests |
EUR 521 |
Chicken MUC7 ELISA Kit |
ECKM0361 |
Abclonal |
96Tests |
EUR 521 |
Canine MUC7 ELISA Kit |
ECM0361 |
Abclonal |
96Tests |
EUR 521 |
Goat MUC7 ELISA Kit |
EGTM0361 |
Abclonal |
96Tests |
EUR 521 |
Porcine MUC7 ELISA Kit |
EPM0361 |
Abclonal |
96Tests |
EUR 521 |
Sheep MUC7 ELISA Kit |
ESM0361 |
Abclonal |
96Tests |
EUR 521 |
Rat MUC7 ELISA Kit |
ERM0361 |
Abclonal |
96Tests |
EUR 521 |
Rabbit MUC7 ELISA Kit |
ERTM0361 |
Abclonal |
96Tests |
EUR 521 |
Monkey MUC7 ELISA Kit |
EMKM0361 |
Abclonal |
96Tests |
EUR 521 |
Mouse MUC7 ELISA Kit |
EMM0361 |
Abclonal |
96Tests |
EUR 521 |
Guinea pig Mucin 7 ELISA kit |
E05M0354-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Mucin 7 ELISA kit |
E05M0354-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Mucin 7 ELISA kit |
E05M0354-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea Pig MUC7 ELISA Kit |
EGM0361 |
Abclonal |
96Tests |
EUR 521 |
Recombinant Human Secreted Phospholipase A2-X |
7-03355 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-X |
7-03356 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-X |
7-03357 |
CHI Scientific |
1mg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-XII |
7-03358 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-XII |
7-03359 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-XII |
7-03360 |
CHI Scientific |
1mg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IB |
7-03361 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IB |
7-03362 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IB |
7-03363 |
CHI Scientific |
1mg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IIA |
7-03364 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IIA |
7-03365 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IIA |
7-03366 |
CHI Scientific |
1mg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IID |
7-03367 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IID |
7-03368 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IID |
7-03369 |
CHI Scientific |
1mg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IIE |
7-03370 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IIE |
7-03371 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-IIE |
7-03372 |
CHI Scientific |
1mg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-V |
7-03373 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-V |
7-03374 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-V |
7-03375 |
CHI Scientific |
1mg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-VII |
7-03376 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-VII |
7-03377 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Secreted Phospholipase A2-VII |
7-03378 |
CHI Scientific |
1mg |
Ask for price |
Human Angiotensin 1-7 (Ang1-7) ELISA Kit |
DLR-Ang1-7-Hu-48T |
DL Develop |
48T |
EUR 501 |
- Should the Human Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Angiotensin 1-7 (Ang1-7) ELISA Kit |
DLR-Ang1-7-Hu-96T |
DL Develop |
96T |
EUR 651 |
- Should the Human Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Angiotensin 1-7 (Ang1-7) ELISA Kit |
RD-Ang1-7-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 503 |
Human Angiotensin 1-7 (Ang1-7) ELISA Kit |
RD-Ang1-7-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 697 |
Human Angiotensin 1-7 (Ang1-7) ELISA Kit |
RDR-Ang1-7-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 525 |
Human Angiotensin 1-7 (Ang1-7) ELISA Kit |
RDR-Ang1-7-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 729 |
MUC7 Antibody |
43220-100ul |
SAB |
100ul |
EUR 252 |
MUC7 Antibody |
1-CSB-PA949093 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
MUC7 Antibody |
1-CSB-PA780399 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100 |
MUC7 Antibody |
DF9642 |
Affbiotech |
200ul |
EUR 304 |
Description: MUC7 Antibody detects endogenous levels of total MUC7. |
MUC7 siRNA |
20-abx925029 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MUC7 |
YF-PA24185 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to MUC7 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human MUC7 shRNA Plasmid |
20-abx953023 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MUC7 Recombinant Protein (Human) |
RP020392 |
ABM |
100 ug |
Ask for price |
Recombinant Human Secreted Protein Acidic & Rich in Cysteine |
7-06505 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Secreted Protein Acidic & Rich in Cysteine |
7-06506 |
CHI Scientific |
50µg |
Ask for price |
Recombinant Human Secreted Protein Acidic & Rich in Cysteine |
7-06507 |
CHI Scientific |
1mg |
Ask for price |
Anti-MUC7 Antibody |
A05210 |
BosterBio |
100ug/vial |
EUR 294 |
MUC7 Blocking Peptide |
DF9642-BP |
Affbiotech |
1mg |
EUR 195 |
MUC7 Conjugated Antibody |
C43220 |
SAB |
100ul |
EUR 397 |
MUC7 cloning plasmid |
CSB-CL851529HU-10ug |
Cusabio |
10ug |
EUR 427 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1134
- Sequence: atgaaaactctgccgctgtttgtgtgcatctgtgcactgagtgcttgcttctcgttcagtgaaggtcgagaaagggatcatgaactacgtcacagaaggcatcatcaccaatcacccaaatctcactttgaattaccacattatcctggactgctagctcaccagaagccgttca
- Show more
|
Description: A cloning plasmid for the MUC7 gene. |
MUC7 Polyclonal Antibody |
ABP59345-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120 |
MUC7 Polyclonal Antibody |
ABP59345-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120 |
MUC7 Polyclonal Antibody |
ABP59345-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120 |
MUC7 Polyclonal Antibody |
ES9828-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MUC7 Polyclonal Antibody |
ES9828-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-MUC7 antibody |
STJ190986 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MUC7 |
Anti-MUC7 (7F2) |
YF-MA10594 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MUC7 |
Anti-MUC7 (1C10) |
YF-MA14331 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MUC7 |
Canine Angiotensin 1-7 (Ang1-7) ELISA Kit |
DLR-Ang1-7-c-48T |
DL Develop |
48T |
EUR 560 |
- Should the Canine Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Canine Angiotensin 1-7 (Ang1-7) ELISA Kit |
DLR-Ang1-7-c-96T |
DL Develop |
96T |
EUR 732 |
- Should the Canine Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Canine Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit |
DLR-Ang1-7-Mu-48T |
DL Develop |
48T |
EUR 512 |
- Should the Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit |
DLR-Ang1-7-Mu-96T |
DL Develop |
96T |
EUR 667 |
- Should the Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Angiotensin 1-7 (Ang1-7) ELISA Kit |
DLR-Ang1-7-Ra-48T |
DL Develop |
48T |
EUR 536 |
- Should the Rat Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Angiotensin 1-7 (Ang1-7) ELISA Kit |
DLR-Ang1-7-Ra-96T |
DL Develop |
96T |
EUR 700 |
- Should the Rat Angiotensin 1-7 (Ang1-7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Angiotensin 1-7 (Ang1-7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Canine Angiotensin 1-7 (Ang1-7) ELISA Kit |
RD-Ang1-7-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 569 |
Canine Angiotensin 1-7 (Ang1-7) ELISA Kit |
RD-Ang1-7-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 792 |
Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit |
RD-Ang1-7-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 516 |
Mouse Angiotensin 1-7 (Ang1-7) ELISA Kit |
RD-Ang1-7-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 716 |
Rat Angiotensin 1-7 (Ang1-7) ELISA Kit |
RD-Ang1-7-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 543 |
Human MUC7(Mucin 7, Secreted) ELISA Kit