Human Ntn4(Netrin 4) ELISA Kit
Human Netrin 4 (Ntn4) ELISA Kit |
RD-Ntn4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Netrin-4 (NTN4) |
RA21023 |
Neuromics |
50 ug |
EUR 435 |
Human Netrin-4,Ntn4 ELISA Kit |
201-12-1298 |
SunredBio |
96 tests |
EUR 440 |
- This Netrin-4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Netrin-4 (NTN4) ELISA Kit |
20-abx152484 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Netrin-4 (NTN4) ELISA Kit |
abx251276-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human NTN4/ Netrin-4 ELISA Kit |
E1805Hu |
Sunlong |
1 Kit |
EUR 571 |
Human NTN4(Netrin-4) ELISA Kit |
EH1954 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78.125-5000 pg/ml
- Uniprot ID: Q9HB63
- Alias: NTN4(Netrin 4)/beta-Netrin/Netrin-4/CDY/CDY1A/chromodomain protein, Y chromosome, 1/chromodomain protein, Y-linked, 1/testis-specific chromodomain protein on Y/testis-specific chromodomain
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
Human Netrin-4, Ntn4 ELISA Kit |
CSB-E11900h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-4, Ntn4 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Netrin-4, Ntn4 ELISA Kit |
1-CSB-E11900h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-4, Ntn4 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Netrin-4 (NTN4) ELISA Kit |
abx576155-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Netrin 4 ELISA Kit (Ntn4) |
RK01972 |
Abclonal |
96 Tests |
EUR 521 |
Human Netrin 4 (Ntn4) ELISA Kit |
SEB835Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Netrin 4 (Ntn4) ELISA Kit |
SEB835Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Netrin 4 (Ntn4) ELISA Kit |
SEB835Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Netrin 4 (Ntn4) ELISA Kit |
SEB835Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 4 (Ntn4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 4 (Ntn4) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Netrin 4 (Ntn4) ELISA Kit |
4-SEB835Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Netrin 4 elisa. Alternative names of the recognized antigen: Beta-Netrin
- Hepar-derived netrin-like protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Netrin 4 (Ntn4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Netrin 4 (Ntn4) Antibody |
20-abx128812 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Netrin 4 (Ntn4) Antibody |
20-abx173747 |
Abbexa |
|
|
|
Netrin-4 (NTN4) Antibody |
abx432030-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Recombinant Netrin 4 (Ntn4) |
4-RPB835Hu01 |
Cloud-Clone |
-
EUR 483.49
-
EUR 232.00
-
EUR 1538.08
-
EUR 579.36
-
EUR 1058.72
-
EUR 386.00
-
EUR 3695.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9HB63
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 59.3kDa
- Isoelectric Point: 7
|
Description: Recombinant Human Netrin 4 expressed in: E.coli |
Mouse Netrin-4(NTN4) ELISA kit |
CSB-EL016129MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Netrin-4 (NTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Netrin-4(NTN4) ELISA kit |
1-CSB-EL016129MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Netrin-4(NTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Monkey Netrin-4 (NTN4) ELISA Kit |
abx360314-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Netrin-4 (NTN4) ELISA Kit |
abx362075-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Netrin-4 (NTN4) ELISA Kit |
abx363302-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Netrin-4 (NTN4) ELISA Kit |
abx356839-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Netrin-4 (NTN4) ELISA Kit |
abx364688-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Mouse Netrin-4 (NTN4) ELISA Kit |
abx518574-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Netrin 4 (Ntn4) Protein |
20-abx166809 |
Abbexa |
-
EUR 676.00
-
EUR 272.00
-
EUR 2068.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Netrin 4 (Ntn4) CLIA Kit |
abx197331-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Netrin-4 (NTN4) CLIA Kit |
20-abx493140 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human Ntn4 (Netrin 4) |
E-EL-H2329 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's Ntn4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Ntn4. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human Ntn4 (Netrin 4) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human Ntn4 (Netrin 4) |
ELK2211 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Netrin 4 (Ntn4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Netrin 4 (Ntn4). N
- Show more
|
Description: A sandwich ELISA kit for detection of Netrin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
CLIA kit for Human Ntn4 (Netrin 4) |
E-CL-H1361 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's Ntn4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human Ntn4 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human Ntn4 (Netrin 4) in samples from Serum, Plasma, Cell supernatant |
Netrin 4 (Ntn4) Polyclonal Antibody (Human) |
4-PAB835Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ntn4 (Glu349~His592)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4) |
Netrin 4 (Ntn4) Polyclonal Antibody (Human), APC |
4-PAB835Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ntn4 (Glu349~His592)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with APC. |
Netrin 4 (Ntn4) Polyclonal Antibody (Human), Biotinylated |
4-PAB835Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ntn4 (Glu349~His592)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with Biotin. |
Netrin 4 (Ntn4) Polyclonal Antibody (Human), Cy3 |
4-PAB835Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ntn4 (Glu349~His592)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with Cy3. |
Netrin 4 (Ntn4) Polyclonal Antibody (Human), FITC |
4-PAB835Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ntn4 (Glu349~His592)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with FITC. |
Netrin 4 (Ntn4) Polyclonal Antibody (Human), HRP |
4-PAB835Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ntn4 (Glu349~His592)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with HRP. |
Netrin 4 (Ntn4) Polyclonal Antibody (Human), PE |
4-PAB835Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ntn4 (Glu349~His592)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with PE. |
Netrin 4 (Ntn4) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB835Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ntn4 (Glu349~His592)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human Netrin 4 (Ntn4). This antibody is labeled with APC-Cy7. |
Netrin 4 antibody |
70R-7141 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Netrin 4 antibody raised against the N terminal of NTN4 |
NTN4 ELISA Kit (Human) (OKAN05746) |
OKAN05746 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.5 pg/mL |
NTN4 ELISA Kit (Human) (OKCD07716) |
OKCD07716 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: NTN4 contains 3 laminin EGF-like domains, 1 laminin N-terminal domain and 1 NTR domain. NTN4 may play an important role in neural, kidney and vascular development. It promotes neurite elongation from olfactory bulb explants. NTN4 belongs to a family of proteins related to laminins (see LAMA1, MIM 150320) Koch et al. (2000)....;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 3.1pg/mL |
NTN4 ELISA Kit (Human) (OKEH04720) |
OKEH04720 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL |
Netrin 4 Blocking Peptide |
33R-2330 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NTN4 antibody, catalog no. 70R-7141 |
Human Netrin 1 ELISA kit |
E01N0102-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Netrin 1 ELISA kit |
E01N0102-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Netrin 1 ELISA kit |
E01N0102-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
NTN4 ELISA Kit (Mouse) (OKCA02417) |
OKCA02417 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: May play an important role in neural, kidney and vascular development. Promotes neurite elongation from olfactory bulb explants.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 7.81 pg/mL |
Human Netrin-1,Ntn1 ELISA Kit |
201-12-1278 |
SunredBio |
96 tests |
EUR 440 |
- This Netrin-1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Netrin 1 (Ntn1) ELISA Kit |
DLR-Ntn1-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Netrin 1 (Ntn1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Netrin 1 (Ntn1) ELISA Kit |
DLR-Ntn1-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Netrin 1 (Ntn1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Netrin-1 (NTN1) ELISA Kit |
20-abx152483 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Netrin-1 (NTN1) ELISA Kit |
abx251273-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Netrin-1 |
EK3998 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Netrin-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human NTN1/ Netrin-1 ELISA Kit |
E1804Hu |
Sunlong |
1 Kit |
EUR 571 |
Human NTN1(Netrin-1) ELISA Kit |
EH1951 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: O95631
- Alias: Ntn1(Netrin 1)/netrin-1/Lnetrin 1, mouse, homolog of
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Netrin-1, Ntn1 ELISA Kit |
CSB-E11899h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-1, Ntn1 in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Netrin-1, Ntn1 ELISA Kit |
1-CSB-E11899h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Netrin-1, Ntn1 in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Netrin-1 (NTN1) ELISA Kit |
abx575464-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Netrin 1 ELISA Kit (Ntn1) |
RK01971 |
Abclonal |
96 Tests |
EUR 521 |
Human Netrin 1 (Ntn1) ELISA Kit |
SEB827Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Netrin 1 (Ntn1) ELISA Kit |
SEB827Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Netrin 1 (Ntn1) ELISA Kit |
SEB827Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Netrin 1 (Ntn1) ELISA Kit |
SEB827Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Netrin 1 (Ntn1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Netrin 1 (Ntn1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Netrin 1 (Ntn1) ELISA Kit |
4-SEB827Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Netrin 1 elisa. Alternative names of the recognized antigen: NTN1L
- Epididymis tissue protein Li 131P
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Netrin 1 (Ntn1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Netrin 1 (Ntn1) ELISA Kit |
RDR-Ntn1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Netrin 1 (Ntn1) ELISA Kit |
RDR-Ntn1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Netrin 1 (Ntn1) ELISA Kit |
RD-Ntn1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Netrin 1 (Ntn1) ELISA Kit |
RD-Ntn1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
NTN4 siRNA |
20-abx926510 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NTN4 siRNA |
20-abx926511 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IL-4 Interleukin 4 Human Recombinant Protein, Yeast |
PROTP05112-4 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Rat Netrin 1 ELISA kit |
E02N0102-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Netrin 1 ELISA kit |
E02N0102-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Netrin 1 ELISA kit |
E02N0102-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Netrin 1 ELISA kit |
E04N0102-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Netrin 1 ELISA kit |
E04N0102-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Netrin 1 ELISA kit |
E04N0102-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Netrin 1 ELISA kit |
E03N0102-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Netrin 1 ELISA kit |
E03N0102-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Netrin 1 ELISA kit |
E03N0102-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Netrin 1 ELISA kit |
E06N0102-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Netrin 1 ELISA kit |
E06N0102-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Netrin 1 ELISA kit |
E06N0102-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Netrin 1 ELISA kit |
E08N0102-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Netrin 1 ELISA kit |
E08N0102-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Netrin 1 ELISA kit |
E08N0102-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Netrin 1 ELISA kit |
E07N0102-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Netrin 1 ELISA kit |
E07N0102-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Netrin 1 ELISA kit |
E07N0102-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Netrin 1 ELISA kit |
E09N0102-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Netrin 1 ELISA kit |
E09N0102-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Netrin 1 ELISA kit |
E09N0102-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Netrin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
DLR-CA72-4-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RDR-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit |
RD-CA72-4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human NTN4 shRNA Plasmid |
20-abx961762 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NTN4 Recombinant Protein (Human) |
RP021772 |
ABM |
100 ug |
Ask for price |
ELISA kit for Human Ntn1 (Netrin 1) |
E-EL-H2328 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's Ntn1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human Ntn1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human Ntn1 (Netrin 1) in samples from Serum, Plasma, Cell supernatant |
Human Netrin receptor UNC5B (UNC5B) ELISA Kit |
abx259097-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Netrin receptor UNC5C (UNC5C) ELISA Kit |
abx251732-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human UNC5C(Netrin receptor UNC5C) ELISA Kit |
EH2373 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O95185
- Alias: UNC5C/UNC5H3/netrin receptor UNC5C/Protein unc-5 homolog 3/Protein unc-5 homolog C/unc-5 homolog 3/unc-5 homolog C(C. elegans)/UNC5H3unc5(C.elegans homolog) c
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human UNC5B(Netrin Receptor UNC5B) ELISA Kit |
EH4330 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.313-20 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
ELISA kit for Human Netrin receptor UNC5C |
EK4779 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Netrin receptor UNC5C in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human UNC5C/ Netrin receptor UNC5C ELISA Kit |
E2644Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Netrin receptor UNC5C, UNC5C ELISA KIT |
ELI-16914h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Netrin receptor UNC5A, UNC5A ELISA KIT |
ELI-17718h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Netrin receptor UNC5B, UNC5B ELISA KIT |
ELI-51730h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human Ntn1 (Netrin 1) |
ELK2210 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Netrin 1 (Ntn1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Netrin 1 (Ntn1). N
- Show more
|
Description: A sandwich ELISA kit for detection of Netrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Netrin receptor DCC(DCC) ELISA kit |
CSB-EL006536HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Netrin receptor DCC (DCC) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Netrin receptor DCC(DCC) ELISA kit |
1-CSB-EL006536HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Netrin receptor DCC(DCC) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Netrin receptor UNC5A (UNC5A) ELISA Kit |
abx384131-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Netrin receptor UNC5D (UNC5D) ELISA Kit |
abx384133-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Netrin Receptor DCC (DCC) ELISA Kit |
abx386806-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Netrin receptor UNC5D, UNC5D ELISA KIT |
ELI-39862h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human Netrin-1 (NTN1) |
KTE62214-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Human Netrin-1 (NTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Netrin-1 (NTN1) |
KTE62214-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Human Netrin-1 (NTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Netrin-1 (NTN1) |
KTE62214-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Human Netrin-1 (NTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Netrin G1 (Netrin G1) Antibody |
20-abx116878 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Netrin G1 (Netrin G1) Antibody |
abx235667-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Netrin G1 (Netrin G1) Antibody |
abx433020-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
NTN4 Polyclonal Antibody |
28347-100ul |
SAB |
100ul |
EUR 252 |
NTN4 Polyclonal Antibody |
28347-50ul |
SAB |
50ul |
EUR 187 |
NTN4 Rabbit pAb |
A13775-100ul |
Abclonal |
100 ul |
EUR 308 |
NTN4 Rabbit pAb |
A13775-200ul |
Abclonal |
200 ul |
EUR 459 |
NTN4 Rabbit pAb |
A13775-20ul |
Abclonal |
20 ul |
EUR 183 |
NTN4 Rabbit pAb |
A13775-50ul |
Abclonal |
50 ul |
EUR 223 |
NTN4 cloning plasmid |
CSB-CL881014HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1026
- Sequence: atggtccatgggaagtgtatgtgtaagcacaacacagcaggcagccactgccagcactgtgccccgttatacaatgaccggccatgggaggcagctgatggcaaaacgggggctcccaacgagtgcagaacctgcaagtgtaatgggcatgctgatacctgtcacttcgacgtta
- Show more
|
Description: A cloning plasmid for the NTN4 gene. |
Anti-NTN4 antibody |
STJ115720 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. |
Human FibrOut 4, for brain, neural |
4-21552 |
CHI Scientific |
1 ml |
Ask for price |
Human FibrOut 4, for brain, neural |
4-21553 |
CHI Scientific |
5 x 1 ml |
Ask for price |
Recombinant Human 4-1BB Receptor Protein |
PROTQ07011-4 |
BosterBio |
20ug |
EUR 317 |
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor. |
Recombinant Human PF-4 (CXCL4) Protein |
PROTP02776-4 |
BosterBio |
20ug |
EUR 317 |
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines. |
Chicken Netrin 1 (Ntn1) ELISA Kit |
DLR-Ntn1-Ch-48T |
DL Develop |
48T |
EUR 398 |
- Should the Chicken Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Netrin 1 (Ntn1) in samples from serum, plasma or other biological fluids. |
Chicken Netrin 1 (Ntn1) ELISA Kit |
DLR-Ntn1-Ch-96T |
DL Develop |
96T |
EUR 511 |
- Should the Chicken Netrin 1 (Ntn1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Netrin 1 (Ntn1) in samples from serum, plasma or other biological fluids. |
Human Ntn4(Netrin 4) ELISA Kit