Human TEP1(Telomerase Associated Protein 1) ELISA Kit – Biofarmaceutical Research Labs

Human TEP1(Telomerase Associated Protein 1) ELISA Kit

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
RD-TEP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
RD-TEP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
RDR-TEP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
RDR-TEP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
abx570386-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
20-abx153251	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
abx253908-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
SEA558Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
SEA558Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
SEA558Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
SEA558Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit
4-SEA558Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Telomerase Associated Protein 1 elisa. Alternative names of the recognized antigen: TLP1 TP1 TROVE1 VAULT2 p240 TROVE Domain Family Member 1 Telomerase protein component 1 p80 telomerase homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Telomerase Associated Protein 1 (TEP1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Telomerase Associated Protein 1(TEP1)ELISA Kit
QY-E03762	Qayee Biotechnology	96T	EUR 361

Human Telomerase Associated Protein 1 (TEP1) Protein
20-abx166065	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Telomerase Associated Protein 1 (TEP1) Antibody
20-abx128715	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Telomerase Associated Protein 1 (TEP1) Antibody
20-abx135788	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody
20-abx013770	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody
20-abx174733	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Telomerase Associated Protein 1 (TEP1) Antibody
20-abx322919	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody
abx330381-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody
20-abx211409	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody
20-abx211410	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Telomerase Associated Protein 1 (TEP1)
4-RPA558Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99973 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.7kDa Isoelectric Point: 5.4
Description: Recombinant Human Telomerase Associated Protein 1 expressed in: E.coli

Pig Telomerase Associated Protein 1 (TEP1) ELISA Kit
abx360836-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Telomerase Associated Protein 1 (TEP1) ELISA Kit
abx363544-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Telomerase Associated Protein 1 (TEP1) ELISA Kit
abx513307-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Telomerase Associated Protein 1 (TEP1) ELISA Kit
abx513308-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Monkey Telomerase Associated Protein 1 (TEP1) ELISA Kit
abx358774-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Telomerase Associated Protein 1 (TEP1) ELISA Kit
abx355796-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Telomerase Associated Protein 1(TEP1)ELISA Kit
QY-E10132	Qayee Biotechnology	96T	EUR 361

Mouse Telomerase Associated Protein 1(TEP1)ELISA Kit
QY-E21432	Qayee Biotechnology	96T	EUR 374

Nude Telomerase Associated Protein 1(TEP1)ELISA Kit
QY-E90085	Qayee Biotechnology	96T	EUR 478

Human Telomerase Associated Protein 1 (TEP1) CLIA Kit
abx196319-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Telomerase Associated Protein 1 (TEP1) CLIA Kit
20-abx491665	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human TEP1 (Telomerase Associated Protein 1)
ELK2602	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Telomerase Associated Protein 1 (TEP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi Show more
Description: A sandwich ELISA kit for detection of Telomerase Associated Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human TEP1 (Telomerase Associated Protein 1)
E-EL-H1111	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TEP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TEP1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TEP1 (Telomerase Associated Protein 1) in samples from Serum, Plasma, Cell supernatant

Telomerase Associated Protein 1 (TEP1) Antibody Pair
abx117621-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

Telomerase-associated protein 1 (TEP1) polyclonal antibody
ABP-PAB-02284	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

CLIA kit for Human TEP1 (Telomerase Associated Protein 1)
E-CL-H0744	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's TEP1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human TEP1 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human TEP1 (Telomerase Associated Protein 1) in samples from Serum, Plasma, Cell supernatant

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human)
4-PAA558Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TEP1 (Glu2368~Glu2627) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1)

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), APC
4-PAA558Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TEP1 (Glu2368~Glu2627) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with APC.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), Biotinylated
4-PAA558Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TEP1 (Glu2368~Glu2627) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with Biotin.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), Cy3
4-PAA558Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TEP1 (Glu2368~Glu2627) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with Cy3.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), FITC
4-PAA558Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TEP1 (Glu2368~Glu2627) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with FITC.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), HRP
4-PAA558Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TEP1 (Glu2368~Glu2627) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with HRP.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), PE
4-PAA558Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TEP1 (Glu2368~Glu2627) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with PE.

Human TEP1/ Telomerase protein component 1 ELISA Kit
E2467Hu	Sunlong	1 Kit	EUR 571

Human TEP1(Telomerase protein component 1) ELISA Kit
EH0952	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q99973 Alias: TEP1(Telomerase protein component 1)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Telomerase protein component 1 (TEP1)
1-CSB-RP180494h(c)	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 26.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Telomerase protein component 1(TEP1),partial expressed in E.coli

Human Telomerase protein component 1 (TEP1)
1-CSB-RP180494h(N)	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 28.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Telomerase protein component 1(TEP1),partial expressed in E.coli

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), APC-Cy7
4-PAA558Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TEP1 (Glu2368~Glu2627) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human TEP1 ELISA Kit
ELA-E0558h	Lifescience Market	96 Tests	EUR 824

TEP1 ELISA KIT\|Human
EF000655	Lifescience Market	96 Tests	EUR 689

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

ELISA kit for Human Telomerase protein component 1
EK1926	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Telomerase protein component 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human telomerase(TE)ELISA Kit
GA-E0951HM-48T	GenAsia Biotech	48T	EUR 289

Human telomerase(TE)ELISA Kit
GA-E0951HM-96T	GenAsia Biotech	96T	EUR 466

Human Telomerase (TE) ELISA Kit
abx051726-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-10 working days.

Human Telomerase (TE) ELISA Kit
abx253261-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human telomerase,TE ELISA Kit
201-12-0935	SunredBio	96 tests	EUR 440
This telomerase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human telomerase, TE ELISA Kit
CSB-E08021h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human telomerase, TE in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human telomerase, TE ELISA Kit
1-CSB-E08021h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human telomerase, TE in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human telomerase,TE ELISA Kit
CN-03341H1	ChemNorm	96T	EUR 473

Human telomerase,TE ELISA Kit
CN-03341H2	ChemNorm	48T	EUR 323

Human telomerase(TE)ELISA Kit
QY-E03763	Qayee Biotechnology	96T	EUR 361

Human Telomerase Cajal body protein 1, WRAP53 ELISA KIT
ELI-40221h	Lifescience Market	96 Tests	EUR 824

Human Telomerase Cajal body protein 1 (WRAP53) ELISA Kit
abx384315-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Telomerase Cell ELISA Kit
abx595584-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Porcine telomerase ELISA Kit
ELA-E0558p	Lifescience Market	96 Tests	EUR 928

Rabbit telomerase ELISA Kit
ELA-E0558Rb	Lifescience Market	96 Tests	EUR 928

Human Telomerase Reverse Transcriptase ELISA kit
E01T0601-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Telomerase Reverse Transcriptase ELISA kit
E01T0601-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Telomerase Reverse Transcriptase ELISA kit
E01T0601-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human TE (Telomerase)
E-EL-H0164	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TE. Standards or samples are added to the micro ELISA plate wells and combined with the sp Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TE (Telomerase) in samples from Serum, Plasma, Cell supernatant

TEP1 siRNA
20-abx905523	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TEP1 siRNA
20-abx936481	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TEP1 siRNA
20-abx936482	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TEP1 antibody
70R-32097	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal TEP1 antibody

TEP1 Antibody
37271-100ul	SAB	100ul	EUR 252

TEP1 Antibody
34040-100ul	SAB	100ul	EUR 252

TEP1 Antibody
34040-50ul	SAB	50ul	EUR 187

TEP1 Antibody
CSB-PA941380-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

TEP1 Antibody
CSB-PA941380-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

TEP1 Antibody
1-CSB-PA275964	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200

TEP1 Antibody
1-CSB-PA050238	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

TEP1 Antibody
1-CSB-PA065888	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200

anti-TEP1
YF-PA24829	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TEP1

ELISA kit for Human Telomerase (TE) Kit
KTE60502-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Telomerase (TE) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Telomerase (TE) Kit
KTE60502-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Telomerase (TE) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Telomerase (TE) Kit
KTE60502-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Telomerase (TE) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Telomerase- binding protein EST1A, SMG6 ELISA KIT
ELI-48045h	Lifescience Market	96 Tests	EUR 824

Human Telomerase-binding protein EST1A (SMG6) ELISA Kit
abx385416-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Bovine Telomerase Cajal body protein 1, WRAP53 ELISA KIT
ELI-17489b	Lifescience Market	96 Tests	EUR 928

Mouse Telomerase Cajal body protein 1, Wrap53 ELISA KIT
ELI-28755m	Lifescience Market	96 Tests	EUR 865

Mouse Telomerase Cajal body protein 1 (WRAP53) ELISA Kit
abx390859-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Telomerase Cajal body protein 1 (WRAP53) ELISA Kit
abx392116-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

WRAP53 ELISA Kit\| Bovine Telomerase Cajal body protein 1 ELISA
EF012023	Lifescience Market	96 Tests	EUR 689

Wrap53 ELISA Kit\| Rat Telomerase Cajal body protein 1 ELISA Kit
EF019476	Lifescience Market	96 Tests	EUR 689

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Guinea pig telomerase ELISA Kit
ELA-E0558Gu	Lifescience Market	96 Tests	EUR 928

Rabbit telomerase,TE ELISA Kit
GA-E0200RB-48T	GenAsia Biotech	48T	EUR 326

Rabbit telomerase,TE ELISA Kit
GA-E0200RB-96T	GenAsia Biotech	96T	EUR 524

Rat telomerase(TE)ELISA Kit
GA-E0226RT-48T	GenAsia Biotech	48T	EUR 317

Rat telomerase(TE)ELISA Kit
GA-E0226RT-96T	GenAsia Biotech	96T	EUR 496

Mouse telomerase(TE)ELISA Kit
GA-E0474MS-48T	GenAsia Biotech	48T	EUR 336

Mouse telomerase(TE)ELISA Kit
GA-E0474MS-96T	GenAsia Biotech	96T	EUR 534

Chicken Telomerase (TE) ELISA Kit
abx354778-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Telomerase (TE) ELISA Kit
abx354924-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Telomerase (TE) ELISA Kit
abx355063-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Telomerase (TE) ELISA Kit
abx355235-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Telomerase (TE) ELISA Kit
abx355377-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Rat Telomerase (TE) ELISA Kit
abx256038-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse telomerase (TE) ELISA Kit
abx257661-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Mouse telomerase, TE ELISA Kit
CSB-E08022m-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse telomerase, TE in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse telomerase, TE ELISA Kit
1-CSB-E08022m	Cusabio	EUR 946.00 EUR 5782.00 EUR 3060.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse telomerase, TE in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat telomerase,TE ELISA Kit
CN-01459R1	ChemNorm	96T	EUR 442

Rat telomerase,TE ELISA Kit
CN-01459R2	ChemNorm	48T	EUR 293

Mouse telomerase,TE ELISA Kit
CN-02328M1	ChemNorm	96T	EUR 435

Mouse telomerase,TE ELISA Kit
CN-02328M2	ChemNorm	48T	EUR 286

Rabbit telomerase,TE ELISA Kit
CN-00711R1	ChemNorm	96T	EUR 441

Rabbit telomerase,TE ELISA Kit
CN-00711R2	ChemNorm	48T	EUR 291

PoFAine telomerase,TE ELISA Kit
CN-01247P1	ChemNorm	96T	EUR 442

PoFAine telomerase,TE ELISA Kit
CN-01247P2	ChemNorm	48T	EUR 293

Rat telomerase(TE)ELISA Kit
QY-E11426	Qayee Biotechnology	96T	EUR 361

Mouse telomerase(TE)ELISA Kit
QY-E21433	Qayee Biotechnology	96T	EUR 374

Rabbit telomerase,TE ELISA Kit
QY-E30099	Qayee Biotechnology	96T	EUR 374

Porcine telomerase (TE) ELISA Kit
QY-E40134	Qayee Biotechnology	96T	EUR 400

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human TEP1 shRNA Plasmid
20-abx954788	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human Telomerase Reverse Transcriptase (TERT) ELISA kit
E01T0063-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase (TERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Telomerase Reverse Transcriptase (TERT) ELISA kit
E01T0063-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase (TERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Telomerase Reverse Transcriptase (TERT) ELISA kit
E01T0063-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase (TERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Telomerase reverse transcriptase
EK4314	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Telomerase reverse transcriptase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TERT/ Telomerase reverse transcriptase ELISA Kit
E2468Hu	Sunlong	1 Kit	EUR 571

Human TERT(Telomerase reverse transcriptase) ELISA Kit
EH2120	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: O14746 Alias: TERT(Telomerase Reverse Transcriptase)/CMM9/DKCA2/DKCB4/EST2/PFBMFT1/TCS1/TP2/TRT/Telomerase-associated protein 2/Telomerase catalytic subunit
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Telomerase reverse transcriptase, TERT ELISA KIT
ELI-06854h	Lifescience Market	96 Tests	EUR 824

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
20-abx153255	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
abx251454-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
DLR-TERT-Hu-48T	DL Develop	48T	EUR 517
Should the Human Telomerase Reverse Transcriptase (TERT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Telomerase Reverse Transcriptase (TERT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
DLR-TERT-Hu-96T	DL Develop	96T	EUR 673
Should the Human Telomerase Reverse Transcriptase (TERT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Telomerase Reverse Transcriptase (TERT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Telomerase reverse transcriptase(TERT) ELISA kit
CSB-EL023391HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Telomerase reverse transcriptase (TERT) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Telomerase reverse transcriptase(TERT) ELISA kit
1-CSB-EL023391HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Telomerase reverse transcriptase(TERT) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
SEC241Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
SEC241Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
SEC241Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
SEC241Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
4-SEC241Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Telomerase Reverse Transcriptase elisa. Alternative names of the recognized antigen: EST2 TCS1 TP2 TRT hEST2 Telomerase catalytic subunit Telomerase-associated protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Telomerase Reverse Transcriptase (TERT) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Telomerase Reverse Transcriptase ELISA Kit (TERT)
RK02371	Abclonal	96 Tests	EUR 521

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
RD-TERT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
RD-TERT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
RDR-TERT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit
RDR-TERT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Telomerase Reverse Transcriptase(TERT)ELISA Kit
QY-E03761	Qayee Biotechnology	96T	EUR 361

TE ELISA Kit\| Rat Telomerase ELISA Kit
EF018067	Lifescience Market	96 Tests	EUR 689

TE ELISA Kit\| Mouse Telomerase ELISA Kit
EF014029	Lifescience Market	96 Tests	EUR 689

GnRH Associated Peptide (GAP) (1-13), human
A1020-1	ApexBio	1 mg	EUR 90
Description: Sequence: Asp-Ala-Glu-Asn-Leu-Ile-Asp-Ser-Phe-Gln-Glu-Ile-ValThe cloned complementary DNA sequence encoding the human gonadotropin-releasing hormone (GnRH) precursor protein was used to construct an expression vector for the bacterial synthesis of the 56-amino acid GnRH-associated peptide (GAP).

Human Telomerase（TE)
QY-E05556	Qayee Biotechnology	96T	EUR 361

Wrap53 ELISA Kit\| Mouse Telomerase Cajal body protein 1 ELISA K
EF016503	Lifescience Market	96 Tests	EUR 689

TEP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2357402	ABM	1.0 ug DNA	EUR 154

Human Microtubule associated protein 1 ELISA kit
E01M0223-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Microtubule associated protein 1 ELISA kit
E01M0223-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Microtubule associated protein 1 ELISA kit
E01M0223-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Contactin Associated Protein 1 ELISA kit
E01C0340-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Contactin Associated Protein 1 ELISA kit
E01C0340-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Contactin Associated Protein 1 ELISA kit
E01C0340-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDGFA Associated Protein 1 ELISA kit
E01P0070-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDGFA Associated Protein 1 ELISA kit
E01P0070-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDGFA Associated Protein 1 ELISA kit
E01P0070-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BRCA1 Associated Protein 1 ELISA Kit
ELA-E14117h	Lifescience Market	96 Tests	EUR 824

Human PIN2/TERF1 Interacting, Telomerase Inhibitor 1 (PINX1) ELISA Kit
abx382242-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

TEP1 Conjugated Antibody
C37271	SAB	100ul	EUR 397

TEP1 Rabbit pAb
A9844-100ul	Abclonal	100 ul	EUR 308

TEP1 Rabbit pAb
A9844-200ul	Abclonal	200 ul	EUR 459

TEP1 Rabbit pAb
A9844-20ul	Abclonal	20 ul	EUR 183

TEP1 Rabbit pAb
A9844-50ul	Abclonal	50 ul	EUR 223

TEP1 cloning plasmid
CSB-CL859117HU-10ug	Cusabio	10ug	EUR 2770
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 7884 Sequence: atggaaaaactccatgggcatgtgtctgcccatccagacatcctctccttggagaaccggtgcctggctatgctccctgacttacagcccttggagaaactacatcagcatgtatctacccactcagatatcctctccttgaagaaccagtgcctagccacgcttcctgacctga Show more
Description: A cloning plasmid for the TEP1 gene.

Anti-TEP1 antibody
STJ111886	St John's Laboratory	100 µl	EUR 277
Description: This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants.

Mouse Telomerase Reverse Transcriptase ELISA kit
E03T0601-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Telomerase Reverse Transcriptase ELISA kit
E03T0601-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Telomerase Reverse Transcriptase ELISA kit
E03T0601-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse TE (telomerase)
E-EL-M1125	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse TE. Standards or samples are added to the micro ELISA plate wells and combined with the sp Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse TE (telomerase) in samples from Serum, Plasma, Cell supernatant

Rat Telomerase Reverse Transcriptase ELISA kit
E02T0601-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Telomerase Reverse Transcriptase ELISA kit
E02T0601-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Telomerase Reverse Transcriptase ELISA kit
E02T0601-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Telomerase Reverse Transcriptase ELISA kit
E04T0601-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Telomerase Reverse Transcriptase ELISA kit
E04T0601-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Telomerase Reverse Transcriptase ELISA kit
E04T0601-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Telomerase Colorimetric Cell-Based ELISA Kit
EKC1561	BosterBio	100ul	EUR 572

Dog Telomerase Reverse Transcriptase ELISA kit
E08T0601-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Telomerase Reverse Transcriptase ELISA kit
E08T0601-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Telomerase Reverse Transcriptase ELISA kit
E08T0601-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Telomerase Reverse Transcriptase ELISA kit
E07T0601-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Telomerase Reverse Transcriptase ELISA kit
E07T0601-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Telomerase Reverse Transcriptase ELISA kit
E07T0601-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Telomerase Reverse Transcriptase ELISA kit
E06T0601-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Telomerase Reverse Transcriptase ELISA kit
E06T0601-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Telomerase Reverse Transcriptase ELISA kit
E06T0601-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Telomerase Reverse Transcriptase ELISA kit
E09T0601-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Telomerase Reverse Transcriptase ELISA kit
E09T0601-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Telomerase Reverse Transcriptase ELISA kit
E09T0601-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Telomerase (TE) ELISA Kit
abx354781-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Guinea pig telomerase,TE ELISA Kit
CN-00237G1	ChemNorm	96T	EUR 439

Guinea pig telomerase,TE ELISA Kit
CN-00237G2	ChemNorm	48T	EUR 290

ELISA kit for Rat TE (Telomerase)
E-EL-R0947	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat TE. Standards or samples are added to the micro ELISA plate wells and combined with the spec Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat TE (Telomerase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat Telomerase (TE)
KTE100200-48T	Abbkine	48T	EUR 354
Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary Show more
Description: Quantitative sandwich ELISA for measuring Rat Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Telomerase (TE)
KTE100200-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary Show more
Description: Quantitative sandwich ELISA for measuring Rat Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Telomerase (TE)
KTE100200-96T	Abbkine	96T	EUR 572
Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary Show more
Description: Quantitative sandwich ELISA for measuring Rat Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Telomerase (TE)
KTE80031-48T	Abbkine	48T	EUR 354
Telomerase, also called terminal transferase, is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukar Show more
Description: Quantitative sandwich ELISA for measuring Pig Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Telomerase (TE)
KTE80031-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Telomerase, also called terminal transferase, is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukar Show more
Description: Quantitative sandwich ELISA for measuring Pig Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Telomerase (TE)
KTE80031-96T	Abbkine	96T	EUR 572
Telomerase, also called terminal transferase, is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukar Show more
Description: Quantitative sandwich ELISA for measuring Pig Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Telomerase (TE)
KTE90026-48T	Abbkine	48T	EUR 354
Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Telomerase (TE)
KTE90026-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Telomerase (TE)
KTE90026-96T	Abbkine	96T	EUR 572
Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Telomerase (TE)
KTE10097-48T	Abbkine	48T	EUR 354
Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. Telomerase consists of a protein component with reverse transcriptase activity, encoded by Telomerase, and an RNA component which ser Show more
Description: Quantitative sandwich ELISA for measuring Bovine Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Telomerase (TE)
KTE10097-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. Telomerase consists of a protein component with reverse transcriptase activity, encoded by Telomerase, and an RNA component which ser Show more
Description: Quantitative sandwich ELISA for measuring Bovine Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Telomerase (TE)
KTE10097-96T	Abbkine	96T	EUR 572
Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. Telomerase consists of a protein component with reverse transcriptase activity, encoded by Telomerase, and an RNA component which ser Show more
Description: Quantitative sandwich ELISA for measuring Bovine Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Telomerase (TE)
KTE70362-48T	Abbkine	48T	EUR 354
A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (?????) "en Show more
Description: Quantitative sandwich ELISA for measuring Mouse Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Telomerase (TE)
KTE70362-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (?????) "en Show more
Description: Quantitative sandwich ELISA for measuring Mouse Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Telomerase (TE)
KTE70362-96T	Abbkine	96T	EUR 572
A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (?????) "en Show more
Description: Quantitative sandwich ELISA for measuring Mouse Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Guinea pig telomerase(TE)ELISA Kit
QY-E90065	Qayee Biotechnology	96T	EUR 478

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

SNAP25 Synaptosomal-associated protein 25kda Human Recombinant Protein
PROTP60880-1	BosterBio	Regular: 20ug	EUR 317
Description: SNAP25 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 206 amino acids and having a molecular mass of 23 kDa.

Human TEP1(Telomerase Associated Protein 1) ELISA Kit

Copyright © 2021 Biofarmaceutical Research Labs