Human TEP1(Telomerase Associated Protein 1) ELISA Kit

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

RD-TEP1-Hu-48Tests 48 Tests
EUR 478

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

RD-TEP1-Hu-96Tests 96 Tests
EUR 662

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

RDR-TEP1-Hu-48Tests 48 Tests
EUR 500

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

RDR-TEP1-Hu-96Tests 96 Tests
EUR 692

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

abx253908-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

abx570386-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Telomerase Associated Protein 1(TEP1)ELISA Kit

QY-E03762 96T
EUR 361

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

SEA558Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

SEA558Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

SEA558Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

SEA558Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Associated Protein 1 (TEP1) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Telomerase Associated Protein 1 elisa. Alternative names of the recognized antigen: TLP1
  • TP1
  • TROVE1
  • VAULT2
  • p240
  • TROVE Domain Family Member 1
  • Telomerase protein component 1
  • p80 telomerase homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Telomerase Associated Protein 1 (TEP1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Telomerase Associated Protein 1 (TEP1) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Telomerase Associated Protein 1 (TEP1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Telomerase Associated Protein 1 (TEP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Telomerase Associated Protein 1 (TEP1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody

abx330381-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Telomerase Associated Protein 1 (TEP1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Telomerase Associated Protein 1 (TEP1)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99973
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.7kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Telomerase Associated Protein 1 expressed in: E.coli

Pig Telomerase Associated Protein 1 (TEP1) ELISA Kit

abx360836-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Telomerase Associated Protein 1 (TEP1) ELISA Kit

abx358774-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Telomerase Associated Protein 1 (TEP1) ELISA Kit

abx355796-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Telomerase Associated Protein 1 (TEP1) ELISA Kit

abx363544-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Telomerase Associated Protein 1 (TEP1) ELISA Kit

abx513307-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Telomerase Associated Protein 1 (TEP1) ELISA Kit

abx513308-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Telomerase Associated Protein 1(TEP1)ELISA Kit

QY-E10132 96T
EUR 361

Mouse Telomerase Associated Protein 1(TEP1)ELISA Kit

QY-E21432 96T
EUR 374

Nude Telomerase Associated Protein 1(TEP1)ELISA Kit

QY-E90085 96T
EUR 478

Human Telomerase Associated Protein 1 (TEP1) CLIA Kit

abx196319-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Telomerase Associated Protein 1 (TEP1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human TEP1 (Telomerase Associated Protein 1)

E-EL-H1111 1 plate of 96 wells
EUR 534
  • Gentaur's TEP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TEP1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TEP1 (Telomerase Associated Protein 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human TEP1 (Telomerase Associated Protein 1)

ELK2602 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Telomerase Associated Protein 1 (TEP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of Telomerase Associated Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Telomerase Associated Protein 1 (TEP1) Antibody Pair

abx117621-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Telomerase-associated protein 1 (TEP1) polyclonal antibody

ABP-PAB-02284 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

CLIA kit for Human TEP1 (Telomerase Associated Protein 1)

E-CL-H0744 1 plate of 96 wells
EUR 584
  • Gentaur's TEP1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human TEP1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human TEP1 (Telomerase Associated Protein 1) in samples from Serum, Plasma, Cell supernatant

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1)

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with APC.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with Biotin.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with Cy3.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with FITC.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with HRP.

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with PE.

Human TEP1/ Telomerase protein component 1 ELISA Kit

E2467Hu 1 Kit
EUR 571

Human TEP1(Telomerase protein component 1) ELISA Kit

EH0952 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q99973
  • Alias: TEP1(Telomerase protein component 1)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Telomerase protein component 1 (TEP1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 26.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Telomerase protein component 1(TEP1),partial expressed in E.coli

Human Telomerase protein component 1 (TEP1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Telomerase protein component 1(TEP1),partial expressed in E.coli

Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human TEP1 ELISA Kit

ELA-E0558h 96 Tests
EUR 824


EF000655 96 Tests
EUR 689

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

TEP1 ELISA Kit (Human) (OKCD06489)

OKCD06489 96 Wells
EUR 753
Description: Description of target: Telomerase-associated protein 1;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

ELISA kit for Human Telomerase protein component 1

EK1926 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Telomerase protein component 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human telomerase,TE ELISA Kit

201-12-0935 96 tests
EUR 440
  • This telomerase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Telomerase (TE) ELISA Kit

abx051726-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.

Human Telomerase (TE) ELISA Kit

abx253261-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human telomerase, TE ELISA Kit

CSB-E08021h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human telomerase, TE in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human telomerase, TE ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human telomerase, TE in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human telomerase,TE ELISA Kit

CN-03341H1 96T
EUR 473

Human telomerase,TE ELISA Kit

CN-03341H2 48T
EUR 323

Human telomerase(TE)ELISA Kit

GA-E0951HM-48T 48T
EUR 289

Human telomerase(TE)ELISA Kit

GA-E0951HM-96T 96T
EUR 466

Human telomerase(TE)ELISA Kit

QY-E03763 96T
EUR 361

Human Telomerase Cajal body protein 1 (WRAP53) ELISA Kit

abx384315-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Telomerase Cajal body protein 1, WRAP53 ELISA KIT

ELI-40221h 96 Tests
EUR 824

TEP1 ELISA Kit (Mouse) (OKEH05798)

OKEH05798 96 Wells
EUR 662
Description: Description of target: Component of the telomerase ribonucleoprotein complex that is essential for the replication of chromosome termini. Also component of the ribonucleoprotein vaults particle, a multi-subunit structure involved in nucleo-cytoplasmic transport. Responsible for the localizing and stabilizing vault RNA (vRNA) association in the vault ribonucleoprotein particle. Binds to TERC.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.435 ng/mL

Porcine telomerase ELISA Kit

ELA-E0558p 96 Tests
EUR 928

Rabbit telomerase ELISA Kit

ELA-E0558Rb 96 Tests
EUR 928

Telomerase Cell ELISA Kit

abx595584-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

TEP1 ELISA Kit (Human) : 96 Wells (OKEH00524)

OKEH00524 96 Wells
EUR 662
Description: Description of target: Component of the telomerase ribonucleoprotein complex that is essential for the replication of chromosome termini. Also component of the ribonucleoprotein vaults particle, a multi-subunit structure involved in nucleo-cytoplasmic transport. Responsible for the localizing and stabilizing vault RNA (vRNA) association in the vault ribonucleoprotein particle. Binds to TERC.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.067 ng/mL

ELISA kit for Human TE (Telomerase)

E-EL-H0164 1 plate of 96 wells
EUR 534
  • Gentaur's TE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TE. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TE (Telomerase) in samples from Serum, Plasma, Cell supernatant

Human Telomerase Reverse Transcriptase ELISA kit

E01T0601-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Telomerase Reverse Transcriptase ELISA kit

E01T0601-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Telomerase Reverse Transcriptase ELISA kit

E01T0601-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TEP1 antibody

70R-32097 100 ug
EUR 327
Description: Rabbit polyclonal TEP1 antibody

TEP1 Antibody

34040-100ul 100ul
EUR 252

TEP1 Antibody

34040-50ul 50ul
EUR 187

TEP1 Antibody

37271-100ul 100ul
EUR 252

TEP1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

TEP1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200

TEP1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

TEP1 Antibody

CSB-PA941380-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

TEP1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA24829 50 ul
EUR 334
Description: Mouse polyclonal to TEP1

ELISA kit for Human Telomerase (TE)  Kit

KTE60502-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Telomerase (TE)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Telomerase (TE)  Kit

KTE60502-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Telomerase (TE)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Telomerase (TE)  Kit

KTE60502-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Telomerase (TE)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Telomerase-binding protein EST1A (SMG6) ELISA Kit

abx385416-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Telomerase- binding protein EST1A, SMG6 ELISA KIT

ELI-48045h 96 Tests
EUR 824

Bovine Telomerase Cajal body protein 1, WRAP53 ELISA KIT

ELI-17489b 96 Tests
EUR 928

Mouse Telomerase Cajal body protein 1, Wrap53 ELISA KIT

ELI-28755m 96 Tests
EUR 865

Rat Telomerase Cajal body protein 1 (WRAP53) ELISA Kit

abx392116-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Telomerase Cajal body protein 1 (WRAP53) ELISA Kit

abx390859-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

WRAP53 ELISA Kit| Bovine Telomerase Cajal body protein 1 ELISA

EF012023 96 Tests
EUR 689

Wrap53 ELISA Kit| Rat Telomerase Cajal body protein 1 ELISA Kit

EF019476 96 Tests
EUR 689

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Rat Telomerase (TE) ELISA Kit

abx256038-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse telomerase (TE) ELISA Kit

abx257661-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Guinea pig telomerase ELISA Kit

ELA-E0558Gu 96 Tests
EUR 928

Rabbit telomerase,TE ELISA Kit

CN-00711R1 96T
EUR 441

Rabbit telomerase,TE ELISA Kit

CN-00711R2 48T
EUR 291

PoFAine telomerase,TE ELISA Kit

CN-01247P1 96T
EUR 442

PoFAine telomerase,TE ELISA Kit

CN-01247P2 48T
EUR 293

Mouse telomerase, TE ELISA Kit

CSB-E08022m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse telomerase, TE in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse telomerase, TE ELISA Kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse telomerase, TE in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat telomerase,TE ELISA Kit

CN-01459R1 96T
EUR 442

Rat telomerase,TE ELISA Kit

CN-01459R2 48T
EUR 293

Mouse telomerase,TE ELISA Kit

CN-02328M1 96T
EUR 435

Mouse telomerase,TE ELISA Kit

CN-02328M2 48T
EUR 286

Chicken Telomerase (TE) ELISA Kit

abx354778-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Telomerase (TE) ELISA Kit

abx354924-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Telomerase (TE) ELISA Kit

abx355063-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Telomerase (TE) ELISA Kit

abx355235-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Telomerase (TE) ELISA Kit

abx355377-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse telomerase(TE)ELISA Kit

GA-E0474MS-48T 48T
EUR 336

Mouse telomerase(TE)ELISA Kit

GA-E0474MS-96T 96T
EUR 534

Rabbit telomerase,TE ELISA Kit

GA-E0200RB-48T 48T
EUR 326

Rabbit telomerase,TE ELISA Kit

GA-E0200RB-96T 96T
EUR 524

Rat telomerase(TE)ELISA Kit

GA-E0226RT-48T 48T
EUR 317

Rat telomerase(TE)ELISA Kit

GA-E0226RT-96T 96T
EUR 496

Rat telomerase(TE)ELISA Kit

QY-E11426 96T
EUR 361

Mouse telomerase(TE)ELISA Kit

QY-E21433 96T
EUR 374

Rabbit telomerase,TE ELISA Kit

QY-E30099 96T
EUR 374

Porcine telomerase (TE) ELISA Kit

QY-E40134 96T
EUR 400

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human TEP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

EUR 517
  • Should the Human Telomerase Reverse Transcriptase (TERT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Telomerase Reverse Transcriptase (TERT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

EUR 673
  • Should the Human Telomerase Reverse Transcriptase (TERT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Telomerase Reverse Transcriptase (TERT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Telomerase reverse transcriptase(TERT) ELISA kit

CSB-EL023391HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Telomerase reverse transcriptase (TERT) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Telomerase reverse transcriptase(TERT) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Telomerase reverse transcriptase(TERT) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Telomerase Reverse Transcriptase (TERT) ELISA kit

E01T0063-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase (TERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Telomerase Reverse Transcriptase (TERT) ELISA kit

E01T0063-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase (TERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Telomerase Reverse Transcriptase (TERT) ELISA kit

E01T0063-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase (TERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

abx251454-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Telomerase reverse transcriptase

EK4314 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Telomerase reverse transcriptase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TERT/ Telomerase reverse transcriptase ELISA Kit

E2468Hu 1 Kit
EUR 571

Human TERT(Telomerase reverse transcriptase) ELISA Kit

EH2120 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O14746
  • Alias: TERT(Telomerase Reverse Transcriptase)/CMM9/DKCA2/DKCB4/EST2/PFBMFT1/TCS1/TP2/TRT/Telomerase-associated protein 2/Telomerase catalytic subunit
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Telomerase reverse transcriptase, TERT ELISA KIT

ELI-06854h 96 Tests
EUR 824

Human Telomerase Reverse Transcriptase(TERT)ELISA Kit

QY-E03761 96T
EUR 361

Human Telomerase Reverse Transcriptase ELISA Kit (TERT)

RK02371 96 Tests
EUR 521

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

RD-TERT-Hu-48Tests 48 Tests
EUR 521

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

RD-TERT-Hu-96Tests 96 Tests
EUR 723

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

SEC241Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

SEC241Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

SEC241Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

SEC241Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Telomerase Reverse Transcriptase elisa. Alternative names of the recognized antigen: EST2
  • TCS1
  • TP2
  • TRT
  • hEST2
  • Telomerase catalytic subunit
  • Telomerase-associated protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Telomerase Reverse Transcriptase (TERT) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

RDR-TERT-Hu-48Tests 48 Tests
EUR 544

Human Telomerase Reverse Transcriptase (TERT) ELISA Kit

RDR-TERT-Hu-96Tests 96 Tests
EUR 756

TE ELISA Kit| Rat Telomerase ELISA Kit

EF018067 96 Tests
EUR 689

TE ELISA Kit| Mouse Telomerase ELISA Kit

EF014029 96 Tests
EUR 689

GnRH Associated Peptide (GAP) (1-13), human

A1020-1 1 mg
EUR 90
Description: Sequence: Asp-Ala-Glu-Asn-Leu-Ile-Asp-Ser-Phe-Gln-Glu-Ile-ValThe cloned complementary DNA sequence encoding the human gonadotropin-releasing hormone (GnRH) precursor protein was used to construct an expression vector for the bacterial synthesis of the 56-amino acid GnRH-associated peptide (GAP).

Human Telomerase(TE)

QY-E05556 96T
EUR 361

TEP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2357402 1.0 ug DNA
EUR 154

Wrap53 ELISA Kit| Mouse Telomerase Cajal body protein 1 ELISA K

EF016503 96 Tests
EUR 689

Human Contactin Associated Protein 1 ELISA kit

E01C0340-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Contactin Associated Protein 1 ELISA kit

E01C0340-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Contactin Associated Protein 1 ELISA kit

E01C0340-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Microtubule associated protein 1 ELISA kit

E01M0223-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Microtubule associated protein 1 ELISA kit

E01M0223-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Microtubule associated protein 1 ELISA kit

E01M0223-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDGFA Associated Protein 1 ELISA kit

E01P0070-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDGFA Associated Protein 1 ELISA kit

E01P0070-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PDGFA Associated Protein 1 ELISA kit

E01P0070-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BRCA1 Associated Protein 1 ELISA Kit

ELA-E14117h 96 Tests
EUR 824

Human PIN2/TERF1 Interacting, Telomerase Inhibitor 1 (PINX1) ELISA Kit

abx382242-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

TEP1 Conjugated Antibody

C37271 100ul
EUR 397

TEP1 cloning plasmid

CSB-CL859117HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 7884
  • Sequence: atggaaaaactccatgggcatgtgtctgcccatccagacatcctctccttggagaaccggtgcctggctatgctccctgacttacagcccttggagaaactacatcagcatgtatctacccactcagatatcctctccttgaagaaccagtgcctagccacgcttcctgacctga
  • Show more
Description: A cloning plasmid for the TEP1 gene.

TEP1 Rabbit pAb

A9844-100ul 100 ul
EUR 308

TEP1 Rabbit pAb

A9844-200ul 200 ul
EUR 459

TEP1 Rabbit pAb

A9844-20ul 20 ul
EUR 183

TEP1 Rabbit pAb

A9844-50ul 50 ul
EUR 223

Anti-TEP1 antibody

STJ111886 100 µl
EUR 277
Description: This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants.

ELISA kit for Mouse TE (telomerase)

E-EL-M1125 1 plate of 96 wells
EUR 534
  • Gentaur's TE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse TE. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse TE (telomerase) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat TE (Telomerase)

E-EL-R0947 1 plate of 96 wells
EUR 534
  • Gentaur's TE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat TE. Standards or samples are added to the micro ELISA plate wells and combined with the spec
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat TE (Telomerase) in samples from Serum, Plasma, Cell supernatant

Rat Telomerase Reverse Transcriptase ELISA kit

E02T0601-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Telomerase Reverse Transcriptase ELISA kit

E02T0601-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Telomerase Reverse Transcriptase ELISA kit

E02T0601-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Telomerase Reverse Transcriptase ELISA kit

E04T0601-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Telomerase Reverse Transcriptase ELISA kit

E04T0601-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Telomerase Reverse Transcriptase ELISA kit

E04T0601-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Telomerase Reverse Transcriptase ELISA kit

E03T0601-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Telomerase Reverse Transcriptase ELISA kit

E03T0601-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Telomerase Reverse Transcriptase ELISA kit

E03T0601-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Telomerase Reverse Transcriptase ELISA kit

E08T0601-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Telomerase Reverse Transcriptase ELISA kit

E08T0601-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Telomerase Reverse Transcriptase ELISA kit

E08T0601-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Telomerase Reverse Transcriptase ELISA kit

E07T0601-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Telomerase Reverse Transcriptase ELISA kit

E07T0601-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Telomerase Reverse Transcriptase ELISA kit

E07T0601-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Telomerase Colorimetric Cell-Based ELISA Kit

EKC1561 100ul
EUR 572

Monkey Telomerase Reverse Transcriptase ELISA kit

E09T0601-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Telomerase Reverse Transcriptase ELISA kit

E09T0601-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Telomerase Reverse Transcriptase ELISA kit

E09T0601-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Telomerase Reverse Transcriptase ELISA kit

E06T0601-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Telomerase Reverse Transcriptase ELISA kit

E06T0601-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Telomerase Reverse Transcriptase ELISA kit

E06T0601-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig telomerase,TE ELISA Kit

CN-00237G1 96T
EUR 439

Guinea pig telomerase,TE ELISA Kit

CN-00237G2 48T
EUR 290

Guinea pig Telomerase (TE) ELISA Kit

abx354781-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Rat Telomerase (TE)

KTE100200-48T 48T
EUR 354
  • Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Telomerase (TE)

KTE100200-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Telomerase (TE)

KTE100200-96T 96T
EUR 572
  • Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Telomerase (TE)

KTE10097-48T 48T
EUR 354
  • Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. Telomerase consists of a protein component with reverse transcriptase activity, encoded by Telomerase, and an RNA component which ser
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Telomerase (TE)

KTE10097-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. Telomerase consists of a protein component with reverse transcriptase activity, encoded by Telomerase, and an RNA component which ser
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Telomerase (TE)

KTE10097-96T 96T
EUR 572
  • Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. Telomerase consists of a protein component with reverse transcriptase activity, encoded by Telomerase, and an RNA component which ser
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Telomerase (TE)

KTE80031-48T 48T
EUR 354
  • Telomerase, also called terminal transferase, is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukar
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Telomerase (TE)

KTE80031-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Telomerase, also called terminal transferase, is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukar
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Telomerase (TE)

KTE80031-96T 96T
EUR 572
  • Telomerase, also called terminal transferase, is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukar
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Telomerase (TE)

KTE90026-48T 48T
EUR 354
  • Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Telomerase (TE)

KTE90026-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Telomerase (TE)

KTE90026-96T 96T
EUR 572
  • Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Telomerase (TE)

KTE70362-48T 48T
EUR 354
  • A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (?????) "en
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Telomerase (TE)

KTE70362-5platesof96wells 5 plates of 96 wells
EUR 2252
  • A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (?????) "en
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Telomerase (TE)

KTE70362-96T 96T
EUR 572
  • A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (?????) "en
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human TEP1(Telomerase Associated Protein 1) ELISA Kit