Human TEP1(Telomerase Associated Protein 1) ELISA Kit
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
RD-TEP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
RD-TEP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
RDR-TEP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
RDR-TEP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
abx570386-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
20-abx153251 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
abx253908-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
SEA558Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
SEA558Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
SEA558Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
SEA558Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Associated Protein 1 (TEP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Associated Protein 1 (TEP1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Telomerase Associated Protein 1 (TEP1) ELISA Kit |
4-SEA558Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Telomerase Associated Protein 1 elisa. Alternative names of the recognized antigen: TLP1
- TP1
- TROVE1
- VAULT2
- p240
- TROVE Domain Family Member 1
- Telomerase protein component 1
- p80 telomerase homolog
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Telomerase Associated Protein 1 (TEP1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Telomerase Associated Protein 1 (TEP1) Protein |
20-abx166065 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Telomerase Associated Protein 1 (TEP1) Antibody |
20-abx128715 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Telomerase Associated Protein 1 (TEP1) Antibody |
20-abx135788 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Telomerase Associated Protein 1 (TEP1) Antibody |
20-abx013770 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Telomerase Associated Protein 1 (TEP1) Antibody |
20-abx174733 |
Abbexa |
|
|
|
Telomerase Associated Protein 1 (TEP1) Antibody |
20-abx322919 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Telomerase Associated Protein 1 (TEP1) Antibody |
abx330381-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Telomerase Associated Protein 1 (TEP1) Antibody |
20-abx211409 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Telomerase Associated Protein 1 (TEP1) Antibody |
20-abx211410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Telomerase Associated Protein 1 (TEP1) |
4-RPA558Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q99973
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.7kDa
- Isoelectric Point: 5.4
|
Description: Recombinant Human Telomerase Associated Protein 1 expressed in: E.coli |
Pig Telomerase Associated Protein 1 (TEP1) ELISA Kit |
abx360836-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Telomerase Associated Protein 1 (TEP1) ELISA Kit |
abx363544-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Telomerase Associated Protein 1 (TEP1) ELISA Kit |
abx513307-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Telomerase Associated Protein 1 (TEP1) ELISA Kit |
abx513308-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Monkey Telomerase Associated Protein 1 (TEP1) ELISA Kit |
abx358774-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Telomerase Associated Protein 1 (TEP1) ELISA Kit |
abx355796-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Telomerase Associated Protein 1 (TEP1) CLIA Kit |
abx196319-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Telomerase Associated Protein 1 (TEP1) CLIA Kit |
20-abx491665 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human TEP1 (Telomerase Associated Protein 1) |
ELK2602 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Telomerase Associated Protein 1 (TEP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
- Show more
|
Description: A sandwich ELISA kit for detection of Telomerase Associated Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human TEP1 (Telomerase Associated Protein 1) |
E-EL-H1111 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TEP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TEP1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human TEP1 (Telomerase Associated Protein 1) in samples from Serum, Plasma, Cell supernatant |
Telomerase Associated Protein 1 (TEP1) Antibody Pair |
abx117621-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Telomerase-associated protein 1 (TEP1) polyclonal antibody |
ABP-PAB-02284 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
CLIA kit for Human TEP1 (Telomerase Associated Protein 1) |
E-CL-H0744 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's TEP1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human TEP1 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human TEP1 (Telomerase Associated Protein 1) in samples from Serum, Plasma, Cell supernatant |
Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human) |
4-PAA558Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1) |
Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), APC |
4-PAA558Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with APC. |
Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), Biotinylated |
4-PAA558Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with Biotin. |
Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), Cy3 |
4-PAA558Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with Cy3. |
Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), FITC |
4-PAA558Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with FITC. |
Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), HRP |
4-PAA558Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with HRP. |
Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), PE |
4-PAA558Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with PE. |
Human TEP1/ Telomerase protein component 1 ELISA Kit |
E2467Hu |
Sunlong |
1 Kit |
EUR 571 |
Human TEP1(Telomerase protein component 1) ELISA Kit |
EH0952 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q99973
- Alias: TEP1(Telomerase protein component 1)
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Telomerase protein component 1 (TEP1) |
1-CSB-RP180494h(c) |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 26.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Telomerase protein component 1(TEP1),partial expressed in E.coli |
Human Telomerase protein component 1 (TEP1) |
1-CSB-RP180494h(N) |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 28.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Telomerase protein component 1(TEP1),partial expressed in E.coli |
Telomerase Associated Protein 1 (TEP1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA558Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TEP1 (Glu2368~Glu2627)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Telomerase Associated Protein 1 (TEP1). This antibody is labeled with APC-Cy7. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
ELISA kit for Human Telomerase protein component 1 |
EK1926 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Telomerase protein component 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human Telomerase (TE) ELISA Kit |
abx051726-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-10 working days.
|
Human Telomerase (TE) ELISA Kit |
abx253261-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human telomerase,TE ELISA Kit |
201-12-0935 |
SunredBio |
96 tests |
EUR 440 |
- This telomerase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human telomerase, TE ELISA Kit |
CSB-E08021h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human telomerase, TE in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human telomerase, TE ELISA Kit |
1-CSB-E08021h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human telomerase, TE in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human telomerase,TE ELISA Kit |
CN-03341H1 |
ChemNorm |
96T |
EUR 473 |
Human telomerase,TE ELISA Kit |
CN-03341H2 |
ChemNorm |
48T |
EUR 323 |
Human Telomerase Cajal body protein 1, WRAP53 ELISA KIT |
ELI-40221h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Telomerase Cajal body protein 1 (WRAP53) ELISA Kit |
abx384315-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Telomerase Cell ELISA Kit |
abx595584-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Human Telomerase Reverse Transcriptase ELISA kit |
E01T0601-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Telomerase Reverse Transcriptase ELISA kit |
E01T0601-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Telomerase Reverse Transcriptase ELISA kit |
E01T0601-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human TE (Telomerase) |
E-EL-H0164 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TE. Standards or samples are added to the micro ELISA plate wells and combined with the sp
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human TE (Telomerase) in samples from Serum, Plasma, Cell supernatant |
TEP1 siRNA |
20-abx905523 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TEP1 siRNA |
20-abx936481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TEP1 siRNA |
20-abx936482 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TEP1 antibody |
70R-32097 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal TEP1 antibody |
TEP1 Antibody |
37271-100ul |
SAB |
100ul |
EUR 252 |
TEP1 Antibody |
34040-100ul |
SAB |
100ul |
EUR 252 |
TEP1 Antibody |
34040-50ul |
SAB |
50ul |
EUR 187 |
TEP1 Antibody |
CSB-PA941380- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
TEP1 Antibody |
CSB-PA941380-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
TEP1 Antibody |
1-CSB-PA275964 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200 |
TEP1 Antibody |
1-CSB-PA050238 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000 |
TEP1 Antibody |
1-CSB-PA065888 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TEP1. Recognizes TEP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200 |
anti-TEP1 |
YF-PA24829 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to TEP1 |
ELISA kit for Human Telomerase (TE) Kit |
KTE60502-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Human Telomerase (TE) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Telomerase (TE) Kit |
KTE60502-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Human Telomerase (TE) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Telomerase (TE) Kit |
KTE60502-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Human Telomerase (TE) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Telomerase- binding protein EST1A, SMG6 ELISA KIT |
ELI-48045h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Telomerase-binding protein EST1A (SMG6) ELISA Kit |
abx385416-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Bovine Telomerase Cajal body protein 1, WRAP53 ELISA KIT |
ELI-17489b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Telomerase Cajal body protein 1, Wrap53 ELISA KIT |
ELI-28755m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Telomerase Cajal body protein 1 (WRAP53) ELISA Kit |
abx390859-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Telomerase Cajal body protein 1 (WRAP53) ELISA Kit |
abx392116-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
WRAP53 ELISA Kit| Bovine Telomerase Cajal body protein 1 ELISA |
EF012023 |
Lifescience Market |
96 Tests |
EUR 689 |
Wrap53 ELISA Kit| Rat Telomerase Cajal body protein 1 ELISA Kit |
EF019476 |
Lifescience Market |
96 Tests |
EUR 689 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Chicken Telomerase (TE) ELISA Kit |
abx354778-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Telomerase (TE) ELISA Kit |
abx354924-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Telomerase (TE) ELISA Kit |
abx355063-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Telomerase (TE) ELISA Kit |
abx355235-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Telomerase (TE) ELISA Kit |
abx355377-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Rat Telomerase (TE) ELISA Kit |
abx256038-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Mouse telomerase (TE) ELISA Kit |
abx257661-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Mouse telomerase, TE ELISA Kit |
CSB-E08022m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse telomerase, TE in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse telomerase, TE ELISA Kit |
1-CSB-E08022m |
Cusabio |
-
EUR 946.00
-
EUR 5782.00
-
EUR 3060.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse telomerase, TE in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat telomerase,TE ELISA Kit |
CN-01459R1 |
ChemNorm |
96T |
EUR 442 |
Rat telomerase,TE ELISA Kit |
CN-01459R2 |
ChemNorm |
48T |
EUR 293 |
Mouse telomerase,TE ELISA Kit |
CN-02328M1 |
ChemNorm |
96T |
EUR 435 |
Mouse telomerase,TE ELISA Kit |
CN-02328M2 |
ChemNorm |
48T |
EUR 286 |
Rabbit telomerase,TE ELISA Kit |
CN-00711R1 |
ChemNorm |
96T |
EUR 441 |
Rabbit telomerase,TE ELISA Kit |
CN-00711R2 |
ChemNorm |
48T |
EUR 291 |
PoFAine telomerase,TE ELISA Kit |
CN-01247P1 |
ChemNorm |
96T |
EUR 442 |
PoFAine telomerase,TE ELISA Kit |
CN-01247P2 |
ChemNorm |
48T |
EUR 293 |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human TEP1 shRNA Plasmid |
20-abx954788 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human Telomerase Reverse Transcriptase (TERT) ELISA kit |
E01T0063-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase (TERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Telomerase Reverse Transcriptase (TERT) ELISA kit |
E01T0063-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase (TERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Telomerase Reverse Transcriptase (TERT) ELISA kit |
E01T0063-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Telomerase Reverse Transcriptase (TERT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Telomerase reverse transcriptase |
EK4314 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Telomerase reverse transcriptase in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human TERT/ Telomerase reverse transcriptase ELISA Kit |
E2468Hu |
Sunlong |
1 Kit |
EUR 571 |
Human TERT(Telomerase reverse transcriptase) ELISA Kit |
EH2120 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O14746
- Alias: TERT(Telomerase Reverse Transcriptase)/CMM9/DKCA2/DKCB4/EST2/PFBMFT1/TCS1/TP2/TRT/Telomerase-associated protein 2/Telomerase catalytic subunit
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Telomerase reverse transcriptase, TERT ELISA KIT |
ELI-06854h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
20-abx153255 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
abx251454-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
DLR-TERT-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Telomerase Reverse Transcriptase (TERT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Telomerase Reverse Transcriptase (TERT) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
DLR-TERT-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Telomerase Reverse Transcriptase (TERT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Telomerase Reverse Transcriptase (TERT) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Telomerase reverse transcriptase(TERT) ELISA kit |
CSB-EL023391HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Telomerase reverse transcriptase (TERT) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Telomerase reverse transcriptase(TERT) ELISA kit |
1-CSB-EL023391HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Telomerase reverse transcriptase(TERT) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
SEC241Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids. |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
SEC241Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids. |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
SEC241Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids. |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
SEC241Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Telomerase Reverse Transcriptase (TERT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Telomerase Reverse Transcriptase (TERT) in tissue homogenates, cell lysates and other biological fluids. |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
4-SEC241Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Telomerase Reverse Transcriptase elisa. Alternative names of the recognized antigen: EST2
- TCS1
- TP2
- TRT
- hEST2
- Telomerase catalytic subunit
- Telomerase-associated protein 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Telomerase Reverse Transcriptase (TERT) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Telomerase Reverse Transcriptase ELISA Kit (TERT) |
RK02371 |
Abclonal |
96 Tests |
EUR 521 |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
RD-TERT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
RD-TERT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
RDR-TERT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Telomerase Reverse Transcriptase (TERT) ELISA Kit |
RDR-TERT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Telomerase Reverse Transcriptase(TERT)ELISA Kit |
QY-E03761 |
Qayee Biotechnology |
96T |
EUR 361 |
GnRH Associated Peptide (GAP) (1-13), human |
A1020-1 |
ApexBio |
1 mg |
EUR 90 |
Description: Sequence: Asp-Ala-Glu-Asn-Leu-Ile-Asp-Ser-Phe-Gln-Glu-Ile-ValThe cloned complementary DNA sequence encoding the human gonadotropin-releasing hormone (GnRH) precursor protein was used to construct an expression vector for the bacterial synthesis of the 56-amino acid GnRH-associated peptide (GAP). |
Wrap53 ELISA Kit| Mouse Telomerase Cajal body protein 1 ELISA K |
EF016503 |
Lifescience Market |
96 Tests |
EUR 689 |
TEP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2357402 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Microtubule associated protein 1 ELISA kit |
E01M0223-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Microtubule associated protein 1 ELISA kit |
E01M0223-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Microtubule associated protein 1 ELISA kit |
E01M0223-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Microtubule associated protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Contactin Associated Protein 1 ELISA kit |
E01C0340-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Contactin Associated Protein 1 ELISA kit |
E01C0340-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Contactin Associated Protein 1 ELISA kit |
E01C0340-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Contactin Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human PDGFA Associated Protein 1 ELISA kit |
E01P0070-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human PDGFA Associated Protein 1 ELISA kit |
E01P0070-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human PDGFA Associated Protein 1 ELISA kit |
E01P0070-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human PDGFA Associated Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human BRCA1 Associated Protein 1 ELISA Kit |
ELA-E14117h |
Lifescience Market |
96 Tests |
EUR 824 |
Human PIN2/TERF1 Interacting, Telomerase Inhibitor 1 (PINX1) ELISA Kit |
abx382242-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
TEP1 Conjugated Antibody |
C37271 |
SAB |
100ul |
EUR 397 |
TEP1 Rabbit pAb |
A9844-100ul |
Abclonal |
100 ul |
EUR 308 |
TEP1 Rabbit pAb |
A9844-200ul |
Abclonal |
200 ul |
EUR 459 |
TEP1 Rabbit pAb |
A9844-20ul |
Abclonal |
20 ul |
EUR 183 |
TEP1 Rabbit pAb |
A9844-50ul |
Abclonal |
50 ul |
EUR 223 |
TEP1 cloning plasmid |
CSB-CL859117HU-10ug |
Cusabio |
10ug |
EUR 2770 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 7884
- Sequence: atggaaaaactccatgggcatgtgtctgcccatccagacatcctctccttggagaaccggtgcctggctatgctccctgacttacagcccttggagaaactacatcagcatgtatctacccactcagatatcctctccttgaagaaccagtgcctagccacgcttcctgacctga
- Show more
|
Description: A cloning plasmid for the TEP1 gene. |
Anti-TEP1 antibody |
STJ111886 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. |
Mouse Telomerase Reverse Transcriptase ELISA kit |
E03T0601-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Telomerase Reverse Transcriptase ELISA kit |
E03T0601-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Telomerase Reverse Transcriptase ELISA kit |
E03T0601-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Mouse TE (telomerase) |
E-EL-M1125 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse TE. Standards or samples are added to the micro ELISA plate wells and combined with the sp
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse TE (telomerase) in samples from Serum, Plasma, Cell supernatant |
Rat Telomerase Reverse Transcriptase ELISA kit |
E02T0601-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Telomerase Reverse Transcriptase ELISA kit |
E02T0601-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Telomerase Reverse Transcriptase ELISA kit |
E02T0601-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Telomerase Reverse Transcriptase ELISA kit |
E04T0601-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Telomerase Reverse Transcriptase ELISA kit |
E04T0601-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Telomerase Reverse Transcriptase ELISA kit |
E04T0601-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Telomerase Colorimetric Cell-Based ELISA Kit |
EKC1561 |
BosterBio |
100ul |
EUR 572 |
Dog Telomerase Reverse Transcriptase ELISA kit |
E08T0601-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Telomerase Reverse Transcriptase ELISA kit |
E08T0601-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Telomerase Reverse Transcriptase ELISA kit |
E08T0601-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Telomerase Reverse Transcriptase ELISA kit |
E07T0601-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Telomerase Reverse Transcriptase ELISA kit |
E07T0601-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Telomerase Reverse Transcriptase ELISA kit |
E07T0601-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Telomerase Reverse Transcriptase ELISA kit |
E06T0601-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Telomerase Reverse Transcriptase ELISA kit |
E06T0601-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Telomerase Reverse Transcriptase ELISA kit |
E06T0601-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Telomerase Reverse Transcriptase ELISA kit |
E09T0601-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Telomerase Reverse Transcriptase ELISA kit |
E09T0601-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Telomerase Reverse Transcriptase ELISA kit |
E09T0601-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Telomerase Reverse Transcriptase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Telomerase (TE) ELISA Kit |
abx354781-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Guinea pig telomerase,TE ELISA Kit |
CN-00237G1 |
ChemNorm |
96T |
EUR 439 |
Guinea pig telomerase,TE ELISA Kit |
CN-00237G2 |
ChemNorm |
48T |
EUR 290 |
ELISA kit for Rat TE (Telomerase) |
E-EL-R0947 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's TE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat TE. Standards or samples are added to the micro ELISA plate wells and combined with the spec
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat TE (Telomerase) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat Telomerase (TE) |
KTE100200-48T |
Abbkine |
48T |
EUR 354 |
- Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Telomerase (TE) |
KTE100200-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Telomerase (TE) |
KTE100200-96T |
Abbkine |
96T |
EUR 572 |
- Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Telomerase (TE) |
KTE80031-48T |
Abbkine |
48T |
EUR 354 |
- Telomerase, also called terminal transferase, is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Telomerase (TE) |
KTE80031-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Telomerase, also called terminal transferase, is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Telomerase (TE) |
KTE80031-96T |
Abbkine |
96T |
EUR 572 |
- Telomerase, also called terminal transferase, is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Telomerase (TE) |
KTE90026-48T |
Abbkine |
48T |
EUR 354 |
- Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Telomerase (TE) |
KTE90026-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Telomerase (TE) |
KTE90026-96T |
Abbkine |
96T |
EUR 572 |
- Telomerase, also called terminal transferase,is a ribonucleoprotein that adds a species-dependent telomere repeat sequence to the 3' end of telomeres. A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes in most eukary
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Telomerase (TE) |
KTE10097-48T |
Abbkine |
48T |
EUR 354 |
- Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. Telomerase consists of a protein component with reverse transcriptase activity, encoded by Telomerase, and an RNA component which ser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Telomerase (TE) |
KTE10097-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. Telomerase consists of a protein component with reverse transcriptase activity, encoded by Telomerase, and an RNA component which ser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Telomerase (TE) |
KTE10097-96T |
Abbkine |
96T |
EUR 572 |
- Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. Telomerase consists of a protein component with reverse transcriptase activity, encoded by Telomerase, and an RNA component which ser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Telomerase (TE) |
KTE70362-48T |
Abbkine |
48T |
EUR 354 |
- A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (?????) "en
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Telomerase (TE) |
KTE70362-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (?????) "en
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Telomerase (TE) |
KTE70362-96T |
Abbkine |
96T |
EUR 572 |
- A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (?????) "en
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Telomerase (TE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
SNAP25 Synaptosomal-associated protein 25kda Human Recombinant Protein |
PROTP60880-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: SNAP25 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 206 amino acids and having a molecular mass of 23 kDa. |
Human TEP1(Telomerase Associated Protein 1) ELISA Kit