Human UBD(Ubiquitin D) ELISA Kit

Human Ubiquitin D (UBD) ELISA Kit

RD-UBD-Hu-96Tests 96 Tests
EUR 692

human ubiquitin D,UBD ELISA Kit

201-12-1618 96 tests
EUR 440
  • This ubiquitin D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ubiquitin D (UBD) ELISA Kit

abx051880-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Ubiquitin D (UBD) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ubiquitin D (UBD) ELISA Kit

abx253338-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human UBD(Ubiquitin D) ELISA Kit

EH3937 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: O15205
  • Alias: UBD/Diubiquitin/FAT10diubiquitin/GABBR1/UBD-3/ubiquitin D/Ubiquitin-like protein FAT10
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human ubiquitin D,UBD ELISA Kit

ELA-E1744h 96 Tests
EUR 824

Human UBD/ Ubiquitin D ELISA Kit

E2623Hu 1 Kit
EUR 571

Human Ubiquitin D, UBD ELISA KIT

ELI-05657h 96 Tests
EUR 824

Human Ubiquitin D (UBD) ELISA Kit

abx575225-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ubiquitin D(UBD)ELISA Kit

GA-E1634HM-48T 48T
EUR 289

Human ubiquitin D(UBD)ELISA Kit

GA-E1634HM-96T 96T
EUR 466

Human ubiquitin D(UBD)ELISA Kit

QY-E03662 96T
EUR 361

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ubiquitin D elisa. Alternative names of the recognized antigen: UB-D
  • FAT10
  • UBD-3
  • Diubiquitin
  • Ubiquitin-like protein FAT10
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ubiquitin D (UBD) in samples from Serum, plasma and other biological fluids.  with no significant corss-reactivity with analogues from other species.

Human Ubiquitin D (UBD)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin D(UBD) expressed in E.coli

Mouse Ubiquitin D, Ubd ELISA KIT

ELI-05656m 96 Tests
EUR 865

Monkey Ubiquitin D (UBD) ELISA Kit

abx359951-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Ubiquitin D (UBD) ELISA Kit

abx361703-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Ubiquitin D (UBD) ELISA Kit

abx362868-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Ubiquitin D (UBD) ELISA Kit

abx355671-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Ubiquitin D (UBD) ELISA Kit

abx364505-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse Ubiquitin D (UBD) ELISA Kit

abx518320-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Ubiquitin D (UBD) ELISA Kit

abx518321-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human UBD (Ubiquitin D)

E-EL-H1253 1 plate of 96 wells
EUR 534
  • Gentaur's UBD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human UBD. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human UBD (Ubiquitin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human UBD (Ubiquitin D)

ELK2165 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ubiquitin D (UBD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ubiquitin D (UBD
  • Show more
Description: A sandwich ELISA kit for detection of Ubiquitin D from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Ubiquitin D (UBD)

KTE60103-48T 48T
EUR 354
  • Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ubiquitin D (UBD)

KTE60103-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ubiquitin D (UBD)

KTE60103-96T 96T
EUR 572
  • Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Ubiquitin D (UBD) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ubiquitin D (UBD) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ubiquitin D (UBD) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

abx036401-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

abx122611-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ubiquitin D (UBD) Protein

  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

abx239160-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ubiquitin D (UBD) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Ubiquitin D (UBD)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O15205
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.3kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Ubiquitin D expressed in: E.coli

Recombinant Ubiquitin D (UBD)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q921A3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: 9.2
Description: Recombinant Rat Ubiquitin D expressed in: E.coli

Human Ubiquitin D (UBD) CLIA Kit

abx197881-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Ubiquitin D (UBD) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Ubiquitin D (UBD) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CLIA kit for Human UBD (Ubiquitin D)

E-CL-H0813 1 plate of 96 wells
EUR 584
  • Gentaur's UBD CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human UBD . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human UBD (Ubiquitin D) in samples from Serum, Plasma, Cell supernatant

Rat Ubiquitin D (UBD) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ubiquitin D (UBD) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UBD Ubiquitin-D Human Recombinant Protein

PROTO15205 Regular: 5ug
EUR 317
Description: UBD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 188 amino acids (1-165 a.a.) and having a molecular mass of 20.9kDa.;UBD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Ubiquitin D (UBD) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD)

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD)

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with APC.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with Biotin.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with Cy3.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with FITC.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with HRP.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with PE.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with APC.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with Biotin.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with Cy3.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with FITC.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with HRP.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with PE.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with APC-Cy7.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with APC-Cy7.

Ubd/ Rat Ubd ELISA Kit

ELI-05658r 96 Tests
EUR 886


EF007240 96 Tests
EUR 689

Ubiquitin D Antibody

49304-100ul 100ul
EUR 333

Ubiquitin D Antibody

49304-50ul 50ul
EUR 239

Ubiquitin D antibody

70R-5744 50 ug
EUR 467
Description: Rabbit polyclonal Ubiquitin D antibody raised against the N terminal of UBD

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

UBD antibody

70R-21094 50 ul
EUR 435
Description: Rabbit polyclonal UBD antibody

UBD antibody

38663-100ul 100ul
EUR 252

UBD Antibody

DF7373 200ul
EUR 304
Description: UBD Antibody detects endogenous levels of total UBD.

UBD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBD. Recognizes UBD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

UBD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBD Antibody

ABD7373 100 ug
EUR 438

Ubiquitin D Blocking Peptide

33R-8192 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBD antibody, catalog no. 70R-5744

Ubiquitin D Conjugated Antibody

C49304 100ul
EUR 397

Human UBD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UBD Recombinant Protein (Human)

RP033664 100 ug Ask for price

Human Ubiquitin ELISA kit

E01U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin ELISA kit

E01U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin ELISA kit

E01U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ubiquitin ELISA KIT|Human

EF004023 96 Tests
EUR 689

UBD Rabbit pAb

A13397-100ul 100 ul
EUR 308

UBD Rabbit pAb

A13397-200ul 200 ul
EUR 459

UBD Rabbit pAb

A13397-20ul 20 ul
EUR 183

UBD Rabbit pAb

A13397-50ul 50 ul
EUR 223

UBD Blocking Peptide

DF7373-BP 1mg
EUR 195

Polyclonal UBD Antibody

APR11237G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBD . This antibody is tested and proven to work in the following applications:

UBD Conjugated Antibody

C38663 100ul
EUR 397

UBD cloning plasmid

CSB-CL025435HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: atggctcccaatgcttcctgcctctgtgtgcatgtccgttccgaggaatgggatttaatgacctttgatgccaacccatatgacagcgtgaaaaaaatcaaagaacatgtccggtctaagaccaaggttcctgtgcaggaccaggttcttttgctgggctccaagatcttaaagcc
  • Show more
Description: A cloning plasmid for the UBD gene.

UBD Polyclonal Antibody

A50572 100 µg
EUR 570.55
Description: reagents widely cited

UBD Rabbit pAb

A5491-100ul 100 ul
EUR 308

UBD Rabbit pAb

A5491-200ul 200 ul
EUR 459

UBD Rabbit pAb

A5491-20ul 20 ul
EUR 183

UBD Rabbit pAb

A5491-50ul 50 ul
EUR 223

anti- UBD antibody

FNab09160 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin D
  • Uniprot ID: O15205
  • Gene ID: 10537
Description: Antibody raised against UBD

Anti-UBD antibody

PAab09160 100 ug
EUR 386

pENTR223-UBD vector

PVT11863 2 ug
EUR 304

Anti-UBD antibody

STJ27444 100 µl
EUR 277

Anti-UBD antibody

STJ115359 100 µl
EUR 277

UBD ORF Vector (Human) (pORF)

ORF011222 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Ubiquitin,Ub ELISA Kit

201-12-1619 96 tests
EUR 440
  • This Ubiquitin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ubiquitin (Ub) ELISA Kit

DLR-Ub-Hu-48T 48T
EUR 479
  • Should the Human Ubiquitin (Ub) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin (Ub) in samples from serum, plasma or other biological fluids.

Human Ubiquitin (Ub) ELISA Kit

DLR-Ub-Hu-96T 96T
EUR 621
  • Should the Human Ubiquitin (Ub) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin (Ub) in samples from serum, plasma or other biological fluids.

Human Ubiquitin (Ub) ELISA Kit

abx253335-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Ubiquitin,Ub ELISA Kit

CN-04289H1 96T
EUR 434

Human Ubiquitin,Ub ELISA Kit

CN-04289H2 48T
EUR 284

Human UBD(Ubiquitin D) ELISA Kit