Human UBD(Ubiquitin D) ELISA Kit

Human UBD(Ubiquitin D) ELISA Kit

Human Ubiquitin D (UBD) ELISA Kit

RD-UBD-Hu-96Tests 96 Tests
EUR 692

human ubiquitin D,UBD ELISA Kit

201-12-1618 96 tests
EUR 440
  • This ubiquitin D ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ubiquitin D (UBD) ELISA Kit

abx051880-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Ubiquitin D (UBD) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ubiquitin D (UBD) ELISA Kit

abx253338-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human UBD(Ubiquitin D) ELISA Kit

EH3937 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: O15205
  • Alias: UBD/Diubiquitin/FAT10diubiquitin/GABBR1/UBD-3/ubiquitin D/Ubiquitin-like protein FAT10
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human ubiquitin D,UBD ELISA Kit

ELA-E1744h 96 Tests
EUR 824

Human UBD/ Ubiquitin D ELISA Kit

E2623Hu 1 Kit
EUR 571

Human Ubiquitin D, UBD ELISA KIT

ELI-05657h 96 Tests
EUR 824

Human Ubiquitin D (UBD) ELISA Kit

abx575225-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ubiquitin D(UBD)ELISA Kit

GA-E1634HM-48T 48T
EUR 289

Human ubiquitin D(UBD)ELISA Kit

GA-E1634HM-96T 96T
EUR 466

Human ubiquitin D(UBD)ELISA Kit

QY-E03662 96T
EUR 361

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

SEB744Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ubiquitin D (UBD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ubiquitin D (UBD) in serum, plasma and other biological fluids. .

Human Ubiquitin D (UBD) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Ubiquitin D elisa. Alternative names of the recognized antigen: UB-D
  • FAT10
  • UBD-3
  • Diubiquitin
  • Ubiquitin-like protein FAT10
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ubiquitin D (UBD) in samples from Serum, plasma and other biological fluids.  with no significant corss-reactivity with analogues from other species.

Human Ubiquitin D (UBD)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin D(UBD) expressed in E.coli

Mouse Ubiquitin D, Ubd ELISA KIT

ELI-05656m 96 Tests
EUR 865

Monkey Ubiquitin D (UBD) ELISA Kit

abx359951-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Ubiquitin D (UBD) ELISA Kit

abx361703-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Ubiquitin D (UBD) ELISA Kit

abx362868-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Ubiquitin D (UBD) ELISA Kit

abx355671-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Ubiquitin D (UBD) ELISA Kit

abx364505-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse Ubiquitin D (UBD) ELISA Kit

abx518320-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Ubiquitin D (UBD) ELISA Kit

abx518321-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human UBD (Ubiquitin D)

E-EL-H1253 1 plate of 96 wells
EUR 534
  • Gentaur's UBD ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human UBD. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human UBD (Ubiquitin D) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human UBD (Ubiquitin D)

ELK2165 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ubiquitin D (UBD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ubiquitin D (UBD
  • Show more
Description: A sandwich ELISA kit for detection of Ubiquitin D from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Ubiquitin D (UBD)

KTE60103-48T 48T
EUR 354
  • Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ubiquitin D (UBD)

KTE60103-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Ubiquitin D (UBD)

KTE60103-96T 96T
EUR 572
  • Ubiquitin D is a protein encoded by the UBD gene.Using selective cDNA hybridization of a YAC containing the HLA-F locus region on chromosome 6, followed by Southern and Northern blot analyses, Fan et al. (1996) isolated a cDNA, which they called 1F12
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Ubiquitin D (UBD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Ubiquitin D (UBD) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ubiquitin D (UBD) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ubiquitin D (UBD) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

abx036401-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

abx122611-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ubiquitin D (UBD) Protein

  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody

abx239160-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ubiquitin D (UBD) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Ubiquitin D (UBD)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O15205
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.3kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Ubiquitin D expressed in: E.coli

Recombinant Ubiquitin D (UBD)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q921A3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.3kDa
  • Isoelectric Point: 9.2
Description: Recombinant Rat Ubiquitin D expressed in: E.coli

Human Ubiquitin D (UBD) CLIA Kit

abx197881-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Ubiquitin D (UBD) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Ubiquitin D (UBD) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CLIA kit for Human UBD (Ubiquitin D)

E-CL-H0813 1 plate of 96 wells
EUR 584
  • Gentaur's UBD CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human UBD . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human UBD (Ubiquitin D) in samples from Serum, Plasma, Cell supernatant

Rat Ubiquitin D (UBD) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ubiquitin D (UBD) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin D (UBD) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UBD Ubiquitin-D Human Recombinant Protein

PROTO15205 Regular: 5ug
EUR 317
Description: UBD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 188 amino acids (1-165 a.a.) and having a molecular mass of 20.9kDa.;UBD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Ubiquitin D (UBD) Polyclonal Antibody (Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD)

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD)

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with APC.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with Biotin.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with Cy3.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with FITC.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with HRP.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with PE.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with APC.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with Biotin.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with Cy3.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with FITC.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with HRP.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with PE.

Ubiquitin D (UBD) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Gly165)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Ubiquitin D (UBD). This antibody is labeled with APC-Cy7.

Ubiquitin D (UBD) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UBD (Met1~Thr155)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Ubiquitin D (UBD). This antibody is labeled with APC-Cy7.

Ubd/ Rat Ubd ELISA Kit

ELI-05658r 96 Tests
EUR 886


EF007240 96 Tests
EUR 689

UBD ELISA Kit (Human) (OKCD02967)

OKCD02967 96 Wells
EUR 792
Description: Description of target: Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1L-dependent manner. Probably functions as a survival factor. Conjugation ability activated by UBA6. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases such as polycystic kidney disease and Human immunodeficiency virus (HIV)-associated nephropathy (HIVAN).1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.34 ng/mL

UBD ELISA Kit (Mouse) (OKEH05353)

OKEH05353 96 Wells
EUR 662
Description: Description of target: Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1L-dependent manner. Probably functions as a survival factor. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL

UBD ELISA Kit (Rat) (OKEH06112)

OKEH06112 96 Wells
EUR 662
Description: Description of target: Ubiquitin-like protein modifier which can be covalently attached to target protein and subsequently leads to their degradation by the 26S proteasome, in a NUB1L-dependent manner. Probably functions as a survival factor. Promotes the expression of the proteasome subunit beta type-9 (PSMB9/LMP2). Regulates TNF-alpha-induced and LPS-mediated activation of the central mediator of innate immunity NF-kappa-B by promoting TNF-alpha-mediated proteasomal degradation of ubiquitinated-I-kappa-B-alpha. Required for TNF-alpha-induced p65 nuclear translocation in renal tubular epithelial cells (RTECs). May be involved in dendritic cell (DC) maturation, the process by which immature dendritic cells differentiate into fully competent antigen-presenting cells that initiate T-cell responses. Mediates mitotic non-disjunction and chromosome instability, in long-term in vitro culture and cancers, by abbreviating mitotic phase and impairing the kinetochore localization of MAD2L1 during the prometaphase stage of the cell cycle. May be involved in the formation of aggresomes when proteasome is saturated or impaired. Mediates apoptosis in a caspase-dependent manner, especially in renal epithelium and tubular cells during renal diseases.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084 ng/mL

Ubiquitin D Antibody

49304-100ul 100ul
EUR 333

Ubiquitin D Antibody

49304-50ul 50ul
EUR 239

Ubiquitin D antibody

70R-5744 50 ug
EUR 467
Description: Rabbit polyclonal Ubiquitin D antibody raised against the N terminal of UBD

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

UBD antibody

70R-21094 50 ul
EUR 435
Description: Rabbit polyclonal UBD antibody

UBD antibody

38663-100ul 100ul
EUR 252

UBD Antibody

DF7373 200ul
EUR 304
Description: UBD Antibody detects endogenous levels of total UBD.

UBD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBD. Recognizes UBD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

UBD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBD. Recognizes UBD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBD Antibody

ABD7373 100 ug
EUR 438

Ubiquitin D Blocking Peptide

33R-8192 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBD antibody, catalog no. 70R-5744

Ubiquitin D Conjugated Antibody

C49304 100ul
EUR 397

Human UBD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UBD Recombinant Protein (Human)

RP033664 100 ug Ask for price

Human Ubiquitin ELISA kit

E01U0007-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin ELISA kit

E01U0007-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin ELISA kit

E01U0007-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ubiquitin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ubiquitin ELISA KIT|Human

EF004023 96 Tests
EUR 689

UBD Rabbit pAb

A13397-100ul 100 ul
EUR 308

UBD Rabbit pAb

A13397-200ul 200 ul
EUR 459

UBD Rabbit pAb

A13397-20ul 20 ul
EUR 183

UBD Rabbit pAb

A13397-50ul 50 ul
EUR 223

UBD Blocking Peptide

DF7373-BP 1mg
EUR 195

Polyclonal UBD Antibody

APR11237G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBD . This antibody is tested and proven to work in the following applications:

UBD Conjugated Antibody

C38663 100ul
EUR 397

UBD cloning plasmid

CSB-CL025435HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: atggctcccaatgcttcctgcctctgtgtgcatgtccgttccgaggaatgggatttaatgacctttgatgccaacccatatgacagcgtgaaaaaaatcaaagaacatgtccggtctaagaccaaggttcctgtgcaggaccaggttcttttgctgggctccaagatcttaaagcc
  • Show more
Description: A cloning plasmid for the UBD gene.

UBD Polyclonal Antibody

A50572 100 µg
EUR 570.55
Description: reagents widely cited

UBD Rabbit pAb

A5491-100ul 100 ul
EUR 308

UBD Rabbit pAb

A5491-200ul 200 ul
EUR 459

UBD Rabbit pAb

A5491-20ul 20 ul
EUR 183

UBD Rabbit pAb

A5491-50ul 50 ul
EUR 223

anti- UBD antibody

FNab09160 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin D
  • Uniprot ID: O15205
  • Gene ID: 10537
Description: Antibody raised against UBD

Anti-UBD antibody

PAab09160 100 ug
EUR 386

pENTR223-UBD vector

PVT11863 2 ug
EUR 304

Anti-UBD antibody

STJ27444 100 µl
EUR 277

Anti-UBD antibody

STJ115359 100 µl
EUR 277

UBD ORF Vector (Human) (pORF)

ORF011222 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Ubiquitin,Ub ELISA Kit

201-12-1619 96 tests
EUR 440
  • This Ubiquitin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Ubiquitin (Ub) ELISA Kit

DLR-Ub-Hu-48T 48T
EUR 479
  • Should the Human Ubiquitin (Ub) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin (Ub) in samples from serum, plasma or other biological fluids.

Human Ubiquitin (Ub) ELISA Kit

DLR-Ub-Hu-96T 96T
EUR 621
  • Should the Human Ubiquitin (Ub) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin (Ub) in samples from serum, plasma or other biological fluids.

Human UBD(Ubiquitin D) ELISA Kit