Human immunodeficiency virus type 1 env clones from acute and early subtype B infections for standardized assessments of vaccine-elicited neutralizing antibodies.

Induction of broadly cross-reactive neutralizing antibodies is a excessive precedence for AIDS vaccine growth however one which has confirmed troublesome to be achieved. While most immunogens generate antibodies that neutralize a subset of T-cell-line-adapted strains of human immunodeficiency virus type 1 (HIV-1), none to this point have generated a potent, broadly cross-reactive response in opposition to major isolates of the virus.

Even small increments in immunogen enchancment resulting in will increase in neutralizing antibody titers and cross-neutralizing exercise would speed up vaccine growth; nonetheless, a scarcity of uniformity in goal strains utilized by totally different investigators to evaluate cross-neutralization has made the comparability of vaccine-induced antibody responses troublesome. Thus, there’s an pressing want to determine commonplace panels of HIV-1 reference strains for broad distribution.

To facilitate this, full-length gp160 genes have been cloned from acute and early subtype B infections and characterised for use as reference reagents to evaluate neutralizing antibodies in opposition to clade B HIV-1. Individual gp160 clones have been screened for infectivity as Env-pseudotyped viruses in a luciferase reporter gene assay in JC53-BL (TZM-bl) cells. Functional env clones have been sequenced and their neutralization phenotypes characterised through the use of soluble CD4, monoclonal antibodies, and serum samples from contaminated people and noninfected recipients of a recombinant gp120 vaccine.

Env clones from 12 R5 major HIV-1 isolates have been chosen that weren’t unusually delicate or immune to neutralization and comprised a large spectrum of genetic, antigenic, and geographic range. These reference reagents will facilitate proficiency testing and different validation efforts aimed toward bettering assay efficiency throughout laboratories and can be utilized for standardized assessments of vaccine-elicited neutralizing antibodies.

Wnt proteins are lipid-modified and can act as stem cell progress components.

Wnt signalling is concerned in quite a few occasions in animal growth, together with the proliferation of stem cells and the specification of the neural crest. Wnt proteins are probably essential reagents in increasing particular cell varieties, however in distinction to different developmental signalling molecules equivalent to hedgehog proteins and the bone morphogenetic proteins, Wnt proteins have by no means been remoted in an energetic type.

Although Wnt proteins are secreted from cells, secretion is often inefficient and earlier makes an attempt to characterize Wnt proteins have been hampered by their excessive diploma of insolubility. Here we have now remoted energetic Wnt molecules, together with the product of the mouse Wnt3a gene. By mass spectrometry, we discovered the proteins to be palmitoylated on a conserved cysteine.

Enzymatic elimination of the palmitate or site-directed and pure mutations of the modified cysteine end in loss of exercise, and point out that the lipid is essential for signalling. The purified Wnt3a protein induces self-renewal of haematopoietic stem cells, signifying its potential use in tissue engineering.

RGD and different recognition sequences for integrins.

Proteins that include the Arg-Gly-Asp (RGD) attachment web site, along with the integrins that function receptors for them, represent a serious recognition system for cell adhesion. The RGD sequence is the cell attachment web site of a big quantity of adhesive extracellular matrix, blood, and cell floor proteins, and almost half of the over 20 recognized integrins acknowledge this sequence of their adhesion protein ligands.

Some different integrins bind to associated sequences of their ligands. The integrin-binding exercise of adhesion proteins will be reproduced by quick artificial peptides containing the RGD sequence. Such peptides promote cell adhesion when insolubilized onto a floor, and inhibit it when offered to cells in answer. Reagents that bind selectively to just one or just a few of the RGD-directed integrins will be designed by cyclizing peptides with chosen sequences across the RGD and by synthesizing RGD mimics.

As the integrin-mediated cell attachment influences and regulates cell migration, progress, differentiation, and apoptosis, the RGD peptides and mimics can be utilized to probe integrin capabilities in numerous organic programs. Drug design primarily based on the RGD construction could present new therapies for ailments equivalent to thrombosis, osteoporosis, and most cancers.

Quantification of mRNA utilizing real-time reverse transcription PCR (RT-PCR): traits and issues.

The fluorescence-based real-time reverse transcription PCR (RT-PCR) is extensively used for the quantification of steady-state mRNA ranges and is a crucial device for fundamental analysis, molecular medication and biotechnology. Assays are straightforward to carry out, succesful of excessive throughput, and can mix excessive sensitivity with dependable specificity. The know-how is evolving quickly with the introduction of new enzymes, chemistries and instrumentation.

However, whereas real-time RT-PCR addresses many of the difficulties inherent in standard RT-PCR, it has turn out to be more and more clear that it engenders new issues that require pressing consideration. Therefore, along with offering a snapshot of the state-of-the-art in real-time RT-PCR, this overview has a further goal: it’ll describe and talk about critically some of the issues related to deciphering outcomes which can be numerical and lend themselves to statistical evaluation, but whose accuracy is considerably affected by reagent and operator variability.

Reagents that inhibit the ubiquitin-proteasome proteolytic pathway in cells haven’t been out there. Peptide aldehydes that inhibit main peptidase actions of the 20S and 26S proteasomes are proven to cut back the degradation of protein and ubiquitinated protein substrates by 26S particles.

Unlike inhibitors of lysosomal proteolysis, these compounds inhibit the degradation of not solely irregular and short-lived polypeptides but in addition long-lived proteins in intact cells. We used these brokers to check the significance of the proteasome in antigen presentation. When ovalbumin is launched into the cytosol of lymphoblasts, these inhibitors block the presentation on MHC class I molecules of an ovalbumin-derived peptide by stopping its proteolytic technology.

SRPX2 siRNA
20-abx905282	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SRPX2 siRNA
20-abx935187	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SRPX2 siRNA
20-abx935188	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Mouse Sushi repeat-containing protein SRPX2 (Srpx2)
1-CSB-EP819154MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 70.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Sushi repeat-containing protein SRPX2(Srpx2) expressed in E.coli

Mouse Sushi repeat-containing protein SRPX2 (Srpx2)
1-CSB-BP819154MO	Cusabio	EUR 840.00 EUR 332.00 EUR 2170.00 EUR 1135.00 EUR 1579.00 EUR 470.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 54.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Sushi repeat-containing protein SRPX2(Srpx2) expressed in Baculovirus

HEK-293T Telomerase Over-Expressing Cell Pellet
abx069991-1Pellet	Abbexa	1 Pellet	EUR 398
Shipped within 1-3 working days.

SRPX2 Polyclonal Antibody
28966-100ul	SAB	100ul	EUR 252

SRPX2 Polyclonal Antibody
28966-50ul	SAB	50ul	EUR 187

SRPX2 Rabbit pAb
A15434-100ul	Abclonal	100 ul	EUR 308

SRPX2 Rabbit pAb
A15434-200ul	Abclonal	200 ul	EUR 459

SRPX2 Rabbit pAb
A15434-20ul	Abclonal	20 ul	EUR 183

SRPX2 Rabbit pAb
A15434-50ul	Abclonal	50 ul	EUR 223

SRPX2 Blocking Peptide
DF12480-BP	Affbiotech	1mg	EUR 195

Polyclonal SRPX2 Antibody
APR13540G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRPX2 . This antibody is tested and proven to work in the following applications:

SRPX2 cloning plasmid
CSB-CL022690HU-10ug	Cusabio	10ug	EUR 502
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1398 Sequence: atggccagtcagctaactcaaagaggagctctctttctgctgttcttcctaactccggcagtgacaccaacatggtatgcaggttctggctactatccggatgaaagctacaatgaagtatatgcagaggaggtcccacaggctcctgccctggactaccgagtcccccgatggt Show more
Description: A cloning plasmid for the SRPX2 gene.

anti- SRPX2 antibody
FNab08240	FN Test	100µg	EUR 548.75
Immunogen: sushi-repeat-containing protein, X-linked 2 Uniprot ID: O60687 Gene ID: 27286 Research Area: Neuroscience
Description: Antibody raised against SRPX2

Anti-SRPX2 antibody
PAab08240	Lifescience Market	100 ug	EUR 386

Anti-SRPX2 antibody
STJ117629	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a secreted protein that contains three sushi repeat motifs. The encoded protein may play a role in the development of speech and language centers in the brain. This protein may also be involved in angiogenesis. Mutations in this gene are the cause of bilateral perisylvian polymicrogyria, rolandic epilepsy, speech dyspraxia and mental retardation.

Anti-SRPX2 Antibody
STJ503134	St John's Laboratory	100 µg	EUR 476

Bovine Sushi repeat- containing protein SRPX2, SRPX2 ELISA KIT
ELI-18130b	Lifescience Market	96 Tests	EUR 928

Human Sushi repeat- containing protein SRPX2, SRPX2 ELISA KIT
ELI-29242h	Lifescience Market	96 Tests	EUR 824

Mouse Sushi repeat- containing protein SRPX2, Srpx2 ELISA KIT
ELI-53443m	Lifescience Market	96 Tests	EUR 865

Chymase reagent
30C-CP1129	Fitzgerald	5 units	EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent
2330-1000	Biovision		EUR 349

Traut's Reagent
2330-500	Biovision		EUR 207

MTS Reagent
2808-1000	Biovision		EUR 990

MTS Reagent
2808-250	Biovision		EUR 365

MTT Reagent
2809-1G	Biovision		EUR 180

MTT Reagent
2809-5G	Biovision		EUR 544

BOP reagent
5-02141	CHI Scientific	25g	Ask for price

BOP reagent
5-02142	CHI Scientific	100g	Ask for price

Bluing Reagent
BRT030	ScyTek Laboratories	30 ml	EUR 60

Bluing Reagent
BRT125	ScyTek Laboratories	125 ml	EUR 63

Bluing Reagent
BRT3800	ScyTek Laboratories	1 Gal.	EUR 184

Bluing Reagent
BRT500	ScyTek Laboratories	500 ml	EUR 76

Bluing Reagent
BRT999	ScyTek Laboratories	1000 ml	EUR 88

BOP reagent
A7015-100000	ApexBio	100 g	EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent
A7015-25000	ApexBio	25 g	EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent
HY-100951	MedChemExpress	10mM/1mL	EUR 126

Bradford reagent
BDE641	Bio Basic	100ml	EUR 61.01
Product category: Biochemicals/Biology Reagents/Protein Related

Human SRPX2 ELISA Kit
EHS0181	Abclonal	96Tests	EUR 521

Bovine SRPX2 ELISA Kit
EBS0181	Abclonal	96Tests	EUR 521

Chicken SRPX2 ELISA Kit
ECKS0181	Abclonal	96Tests	EUR 521

Canine SRPX2 ELISA Kit
ECS0181	Abclonal	96Tests	EUR 521

Goat SRPX2 ELISA Kit
EGTS0181	Abclonal	96Tests	EUR 521

SRPX2 ELISA KIT\|Human
EF003243	Lifescience Market	96 Tests	EUR 689

Rat SRPX2 shRNA Plasmid
20-abx989971	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SRPX2 shRNA Plasmid
20-abx976738	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal SRPX2 Antibody (Internal)
APR13542G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRPX2 (Internal). This antibody is tested and proven to work in the following applications:

SRPX2 Polyclonal Conjugated Antibody
C28966	SAB	100ul	EUR 397

Human SRPX2 shRNA Plasmid
20-abx959053	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Porcine SRPX2 ELISA Kit
EPS0181	Abclonal	96Tests	EUR 521

Sheep SRPX2 ELISA Kit
ESS0181	Abclonal	96Tests	EUR 521

Rat SRPX2 ELISA Kit
ERS0181	Abclonal	96Tests	EUR 521

Rabbit SRPX2 ELISA Kit
ERTS0181	Abclonal	96Tests	EUR 521

Monkey SRPX2 ELISA Kit
EMKS0181	Abclonal	96Tests	EUR 521

Mouse SRPX2 ELISA Kit
EMS0181	Abclonal	96Tests	EUR 521

SRPX2 Recombinant Protein (Rat)
RP231089	ABM	100 ug	Ask for price

SRPX2 Recombinant Protein (Human)
RP030124	ABM	100 ug	Ask for price

SRPX2 Recombinant Protein (Mouse)
RP175466	ABM	100 ug	Ask for price

SRPX2 Recombinant Protein (Mouse)
RP175469	ABM	100 ug	Ask for price

Anti-SRPX2 Antibody (Biotin)
STJ503135	St John's Laboratory	100 µg	EUR 586

Anti-SRPX2 Antibody (FITC)
STJ503136	St John's Laboratory	100 µg	EUR 586

Arabidopsis Thaliana Lysate
30R-AA023	Fitzgerald	150 ug	EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate
35-1867	Fitzgerald	1 mg	EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate
35-1872	Fitzgerald	1 ml	EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate
35-1873	Fitzgerald	1 ml	EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody
abx234439-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

BL21-lysate Antibody
abx230905-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DH5a-lysate Antibody
abx232362-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Green Algae Lysate
PABL-1306	Alpha Diagnostics	50 ug	EUR 164

BSA (Reagent Grade)
30-AB79	Fitzgerald	1 kg	EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)
30-AB81	Fitzgerald	200 grams	EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit
30100	Biotium	1KIT	EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent
2594-1	Biovision		EUR 207

BODIPY-Acetylene Reagent
2594-5	Biovision		EUR 675

Biotin reagent (HRP)
65C-CE0202	Fitzgerald	5 mg	EUR 244
Description: HRP conjugated biotin labelling reagent

Convoy? Transfection Reagent
1110-1ml	ACTGene		EUR 341

Bradford Dye Reagent
0209R	AthenaES	100 ml	EUR 131

HAMA blocking reagent
85R-1001	Fitzgerald	1 gram	EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent
85R-1001P	Fitzgerald	1 gram	EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent
85R-1003	Fitzgerald	1 gram	EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent
85R-1014	Fitzgerald	50 mg	EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent
85R-1025	Fitzgerald	50 mg	EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent
85R-1026	Fitzgerald	50 mg	EUR 192
Description: HAMA blocking reagent for use in immunoassays

Girard's reagent T
20-abx184099	Abbexa	EUR 203.00 EUR 314.00	100 g 500 g
Shipped within 1-2 weeks.

EL Transfection Reagent
20-abx098880	Abbexa	EUR 384.00 EUR 537.00	0.75 ml 1.5 ml
Shipped within 5-10 working days.

Mycoplasma Prevention Reagent
20-abx098886	Abbexa	EUR 425.00 EUR 509.00	1 ml 5 ml
Shipped within 5-10 working days.

Alcohol, Reagent (70%)
EAS500	ScyTek Laboratories	500 ml	EUR 79

Alcohol, Reagent (70%)
EAS999	ScyTek Laboratories	1000 ml	EUR 101

BCA Reagent, 16ML
C144-16ML	Arbor Assays	16ML	EUR 163

Biolipidure-1002-Reagent
Biolipidure-1002-10	Cusabio	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent
Biolipidure-1002-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent
Biolipidure-103-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent
Biolipidure-103-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent
Biolipidure-1201-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent
Biolipidure-1201-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent
Biolipidure-1301-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent
Biolipidure-1301-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent
Biolipidure-203-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent
Biolipidure-203-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent
Biolipidure-206-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent
Biolipidure-206-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent
Biolipidure-405-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent
Biolipidure-405-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent
Biolipidure-502-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent
Biolipidure-502-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent
Biolipidure-702-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent
Biolipidure-702-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent
Biolipidure-802-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent
Biolipidure-802-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

FcR blocking Reagent
20-abx290024	Abbexa	EUR 377.00 EUR 516.00	200 tests 400 tests
Shipped within 2-3 weeks.

Detection Reagent A
abx296004-120ul	Abbexa	120 ul	EUR 321
Shipped within 5-10 working days.

Mycoplasma Prevention Reagent
20-abx298005	Abbexa	EUR 203.00 EUR 286.00	1 ml 5 ml
Shipped within 5-10 working days.

PhosphoBlocker Blocking Reagent
AKR-103	Cell Biolabs	1L	EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent
AKR-104	Cell Biolabs	4L	EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Tri-RNA Reagent
FATRR-001	Favorgen	100ml	EUR 236

Tri-RNA Reagent
FATRR-002	Favorgen	50ml	EUR 176

Tri-RNA Reagent
FATRR-003	Favorgen	450ml	EUR 645

LP4K Transfection Reagent
LP4K	GenTarget	1.0 ml / vial	EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

PureFection Transfection Reagent
LV750A-1	SBI	1 ml	EUR 359
Category: Lentiviral Technology

HighGene transfection reagent
RM09014	Abclonal	1000μl	EUR 270

TissueDigest Reagent, 20X
T101	Insitus Biotechnologies	10ml	EUR 210

ExFect2000 Transfection Reagent
T202-01	Vazyme	0.5 ml	EUR 227

ExFect2000 Transfection Reagent
T202-02	Vazyme	1 ml	EUR 316

ExFect2000 Transfection Reagent
T202-03	Vazyme	5 ml	EUR 1052

Dissociation Reagent, 1ML
X017-1ML	Arbor Assays	1ML	EUR 109

Dissociation Reagent, 25ML
X017-25ML	Arbor Assays	25ML	EUR 258

Dissociation Reagent, 5ML
X017-5ML	Arbor Assays	5ML	EUR 122

Dissociation Reagent, 1ML
X058-1ML	Arbor Assays	1ML	EUR 73

Dissociation Reagent, 5ML
X058-5ML	Arbor Assays	5ML	EUR 109

DTT (Cleland's reagent)
DB0058	Bio Basic	5g	EUR 84.8
Product category: Electrophoresis Related/Reducing Agents

DTNB (Ellman's Reagent)
DB0113	Bio Basic	5g	EUR 97.85
Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Ethyl acetate Reagent
EC4600	Bio Basic	1L	EUR 79
Product category: Biochemicals/Solvents

n-Heptane Reagent
HC5400	Bio Basic	1L	EUR 79
Product category: Biochemicals/Solvents

Guinea Pig SRPX2 ELISA Kit
EGS0181	Abclonal	96Tests	EUR 521

Polyclonal SRPX2 Antibody (C-Terminus)
APR13541G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRPX2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal SRPX2 Antibody (N-Terminus)
APR13543G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRPX2 (N-Terminus). This antibody is tested and proven to work in the following applications:

Srpx2 ORF Vector (Rat) (pORF)
ORF077031	ABM	1.0 ug DNA	EUR 506

SRPX2 ORF Vector (Human) (pORF)
ORF010042	ABM	1.0 ug DNA	EUR 95

Srpx2 ORF Vector (Mouse) (pORF)
ORF058490	ABM	1.0 ug DNA	EUR 506

Srpx2 ORF Vector (Mouse) (pORF)
ORF058491	ABM	1.0 ug DNA	EUR 506

Human Brain Tissue Lysate
30R-AB017	Fitzgerald	150 ug	EUR 273
Description: Fresh tissue lysate isolated from human brain

Chicken Liver Tissue Lysate
30R-AC011	Fitzgerald	150 ug	EUR 192
Description: Freshly prepared tissue lysate isolated from liver of normal chicken

Human Cerebellum Tissue Lysate
30R-AC058	Fitzgerald	150 ug	EUR 290
Description: Freshly prepared tissue lysate isolated from cerebellum of human brain

Human Hippocampus Tissue Lysate
30R-AH	Fitzgerald	150 ug	EUR 273
Description: Isolated Human Hippocampus Tissue Lysate

Human Heart Tissue Lysate
30R-AH049	Fitzgerald	150 ug	EUR 534
Description: Fresh tissue lysate isolated from human heart

Jurkat cell Lysate (untreated)
2401-100	Biovision		EUR 185

Human Kidney Tissue Lysate
30R-AK003	Fitzgerald	150 ug	EUR 219
Description: Fresh tissue lysate isolated from human kidney

Rabbit Liver Tissue Lysate
30R-AL003	Fitzgerald	150 ug	EUR 252
Description: Fresh tissue lysate prepared from rabbit liver

Human Lung Tissue Lysate
30R-AL006	Fitzgerald	150 ug	EUR 219
Description: Fresh tissue lysate isolated from human lung

Human Midbrain Tissue Lysate
30R-AM011	Fitzgerald	150 ug	EUR 257
Description: Fresh tissue lysate isolated from the midbrain of human brain

Human Pancreas Tissue Lysate
30R-AP030	Fitzgerald	150 ug	EUR 219
Description: Fresh tissue lysate isolated from human pancreas

Human Prostate Tissue Lysate
30R-AP031	Fitzgerald	150 ug	EUR 219
Description: Fresh tissue lysate prepared from normal human prostate

Human Pons Tissue Lysate
30R-AP033	Fitzgerald	150 ug	EUR 235
Description: Fresh tissue lysate isolated from the pons of human brain

By stopping peptide manufacturing from cell proteins, these inhibitors block the meeting of class I molecules. Therefore, the proteasome catalyzes the degradation of the overwhelming majority of cell proteins and generates most peptides offered on MHC class I molecules.

Wnt proteins are lipid-modified and can act as stem cell progress components.

RGD and different recognition sequences for integrins.

Quantification of mRNA utilizing real-time reverse transcription PCR (RT-PCR): traits and issues.

SRPX2 siRNA

SRPX2 siRNA

SRPX2 siRNA

Mouse Sushi repeat-containing protein SRPX2 (Srpx2)

Mouse Sushi repeat-containing protein SRPX2 (Srpx2)

HEK-293T Telomerase Over-Expressing Cell Pellet

SRPX2 Polyclonal Antibody

SRPX2 Polyclonal Antibody

SRPX2 Rabbit pAb

SRPX2 Rabbit pAb

SRPX2 Rabbit pAb

SRPX2 Rabbit pAb

SRPX2 Blocking Peptide

Polyclonal SRPX2 Antibody

SRPX2 cloning plasmid

anti- SRPX2 antibody

Anti-SRPX2 antibody

Anti-SRPX2 antibody

Anti-SRPX2 Antibody

Bovine Sushi repeat- containing protein SRPX2, SRPX2 ELISA KIT

Human Sushi repeat- containing protein SRPX2, SRPX2 ELISA KIT

Mouse Sushi repeat- containing protein SRPX2, Srpx2 ELISA KIT

Chymase reagent

Traut's Reagent

Traut's Reagent

MTS Reagent

MTS Reagent

MTT Reagent

MTT Reagent

BOP reagent

BOP reagent

Bluing Reagent

Bluing Reagent

Bluing Reagent

Bluing Reagent

Bluing Reagent

BOP reagent

BOP reagent

Beaucage reagent

Bradford reagent

Human SRPX2 ELISA Kit

Bovine SRPX2 ELISA Kit

Chicken SRPX2 ELISA Kit

Canine SRPX2 ELISA Kit

Goat SRPX2 ELISA Kit

SRPX2 ELISA KIT|Human

Rat SRPX2 shRNA Plasmid

Mouse SRPX2 shRNA Plasmid

Polyclonal SRPX2 Antibody (Internal)

SRPX2 Polyclonal Conjugated Antibody

Human SRPX2 shRNA Plasmid

Porcine SRPX2 ELISA Kit

Sheep SRPX2 ELISA Kit

Rat SRPX2 ELISA Kit

Rabbit SRPX2 ELISA Kit

Monkey SRPX2 ELISA Kit

Mouse SRPX2 ELISA Kit

SRPX2 Recombinant Protein (Rat)

SRPX2 Recombinant Protein (Human)

SRPX2 Recombinant Protein (Mouse)

SRPX2 Recombinant Protein (Mouse)

Anti-SRPX2 Antibody (Biotin)

Anti-SRPX2 Antibody (FITC)

Arabidopsis Thaliana Lysate

CMV Cell Lysate

HSV1 Cell Lysate

HSV2 Cell Lysate

JM109-lysate Antibody

BL21-lysate Antibody

DH5a-lysate Antibody

Green Algae Lysate

BSA (Reagent Grade)

BSA (Reagent Grade)

Griess Reagent Kit

BODIPY-Acetylene Reagent

BODIPY-Acetylene Reagent

Biotin reagent (HRP)